SubtiWiki SubtiWiki
yjbB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yjbB
168

similar to macrolide-efflux transporter

locus
BSU_11480
Molecular weight
43.69 kDa
pI
8.57
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yjbB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,225,557  1,226,774
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-B293 (yjbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1292 NBRP B. subtilis, Japan]
BKE11480 ([gene|122F9AA09E54AA612C7CDFD62F0635BE710152A0|yjbB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCGTATTTCGCCTCCGCT,  downstream forward: _UP4_TGAGAAACACTTCAAAATGA
BKK11480 ([gene|122F9AA09E54AA612C7CDFD62F0635BE710152A0|yjbB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCGTATTTCGCCTCCGCT,  downstream forward: _UP4_TGAGAAACACTTCAAAATGA

122F9AA09E54AA612C7CDFD62F0635BE710152A0

Page visits: 913

Time of last update: 2022-01-21 03:31:35

Author of last update: Melvin.boenninger