SubtiWiki SubtiWiki
acuC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

acuC
168

protein deacetylase for the control of [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA] activity

locus
BSU_29710
Molecular weight
42.83 kDa
pI
5.06
Protein length
Gene length
function
control of [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA] activity
product
[protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA] deacetylase
essential
no
synonyms
acuC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0123

This gene is a member of the following regulons

Gene
Coordinates
3,041,392  3,042,555
The protein
Catalyzed reaction/ biological activity
deacetylates (and thereby activates) [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA] (together with [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN])  [Pubmed|19136592]
Protein family
histone deacetylase family (single member, according to UniProt)
Structure
[PDB|1C3R] (from Aquifex aeolicus, 35% identity) [pubmed|10490031]
Expression and Regulation
Operons
genes
[gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]-[gene|FC9981CFB9D7EB8ACDA3032EC2F0538988F277AA|acuB]-[gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]
description
[Pubmed|7934817]
regulation
repressed by glucose (3.4-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|7913927,12850135]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|7913927], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7913927], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the mRNA is quite stable (half-life 5 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]→[gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]

2021-09-20 16:16:37

Jstuelk

7

0c83d2dce6fb2fd652b90f3db87e253e0dd5a2cb

C4FEF5C006237E0BF05F8B8DB65202D8D51016FB

Biological materials
Mutant
GP1209 (''[gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]''::''kan''), available in [wiki|Jörg Stülke]'s lab
GP1213 (''[gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]''::''cat'')(''[gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]''::''kan''), available in [wiki|Jörg Stülke]'s lab
1A887 ( ''acuC''::''spc''), [Pubmed|16855235], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A887&Search=1A887 BGSC]
BKE29710 ([gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTCATAGCAGATCCCTTTG,  downstream forward: _UP4_CAAAGAACAAAGTAAAAAAC
BKK29710 ([gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTCATAGCAGATCCCTTTG,  downstream forward: _UP4_CAAAGAACAAAGTAAAAAAC
References
7913927,16855235,7934817,19136592,18487328,26098117,12884008,10490031

1255813797A83D835E0656A2AAAD361B5BB2094B

Page visits: 2007

Time of last update: 2021-09-21 10:24:01

Author of last update: Melvin.boenninger