ligD

ligD
168

DNA repair polymerase/ ligase in non-homologous end joining DNA repair

locus
BSU_13400
Molecular weight
70.03 kDa
pI
6.65
Protein length
Gene length
function
non-homologous end joining DNA repair, repair of gapped DNA substrates
product
DNA repair polymerase/ ligase
essential
no
synonyms
ligD, ykoU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3285

This gene is a member of the following regulons

Gene
Coordinates
1,404,518  1,406,353
Phenotypes of a mutant
sensitivity to ionizing radiation in the stationary phase  [Pubmed|12215643]
sensitivity of spores to several DNA-damaging treatments known to cause double strand breaks, such as UV-ray, X-ray, ultrahigh vacuum and wet heat [Pubmed|16497325,17293412]
a ''[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]'' double mutant is sensitive to radiation [Pubmed|24123749]
reduced resistance towards electron beams [pubmed|31948638]
The protein
Catalyzed reaction/ biological activity
has inherent polymerization and ligase activities that allow it to fill the short gaps that can arise after realignment of the broken ends and to seal the resulting nicks, contributing to genome stability during the stationary phase and germination
has an intrinsic 5'-2-deoxyribose-5-phosphate (dRP) lyase activity located at the N-terminal ligase domain [Pubmed|26826709]
ATP + (deoxyribonucleotide)(n)-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)(m) --> (deoxyribonucleotide)(n+m) + AMP + diphosphate (according to UniProt)
Protein family
N-terminal part: LigD polymerase family (single member, according to UniProt)
C-terminal part: ATP-dependent DNA ligase family (with [protein|B66132676788FBA47D375193A1C01FC6F93E110F|ligB], according to UniProt)
[wiki|Domains]
N-terminal DNA ligase catalytic domain (aa 1 - 331) linked to a C-terminal polymerase domain (aa 332 - 611) [Pubmed|23691176]
Structure
[PDB|6NHX] (N-terminal ligase domain, from Mycobacterium tuberculosis, 26.3% identity) [pubmed|30718283]
[PDB|5OP0] (C-terminal polymerase domain, from Mycobacterium smegmatis, 30% identity) [pubmed|29089537]
[AF|O34398]
Expression and Regulation
Operons
genes
[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|search|SigG], [wiki|SpoVT]) [Pubmed|16497325]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|16497325], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]→[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]

2022-12-11 20:12:35

ghost

21

7fcc8aee83f81918f6eb01c909915f020ead37c2

8BDE381CB52702FA257381283FE46A01B66ABB9F

Biological materials
Mutant
MGNA-A778 (ykoU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/778 NBRP B. subtilis, Japan]
BP141 (Δ''[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [wiki|Fabian Commichau]'s and [wiki|Jörg Stülke]'s labs [pubmed|30863384]
BP142 (Δ''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]-[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [wiki|Fabian Commichau]'s lab
BKE13400 (Δ[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA,  downstream forward: _UP4_TGACTAATGAAGTCAGCTCT
BKK13400 (Δ[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA,  downstream forward: _UP4_TGACTAATGAAGTCAGCTCT
References
Reviews
17938628,22933559
Original Publications
16497325,23691176,12215643,11075926,11566200,17293412,24123749,24123749,25355514,26826709,26961308,15778718,16518468,29234047,30746801,30976810,30718283,29089537,31948638

127CB0930A2D96B18D9261180028818F158C68CB

Page visits: 2301

Time of last update: 2023-02-06 05:06:12

Author of last update: Jstuelk