SubtiWiki SubtiWiki
csbX

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

csbX
168

general stress protein

locus
BSU_27760
Molecular weight
47.70 kDa
pI
8.82
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
csbX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2223

This gene is a member of the following regulons

Gene
Coordinates
2,837,469  2,838,776
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
Paralogous protein(s)
[protein|FF60633F2902E4CA58B34FF3DAFF85B0D4007622|yoaB]
[wiki|Localization]
forespore intermembrane space (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|12B260DBC4E29151364251837FD227593D0BF391|csbX]-[gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]
description
[Pubmed|9099855]
regulation
expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG]) [Pubmed|16497325,9099855]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|22900538], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190,9099855], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|9099855], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224,9099855], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|12B260DBC4E29151364251837FD227593D0BF391|csbX]→[gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]

2021-08-27 05:18:00

ghost

5

afb287c157dfce05e2528e7ea6aede7eb7492bfa

94466CFB0D27D00988F36AF9FE472181F7585610

Biological materials
Mutant
BKE27760 ([gene|12B260DBC4E29151364251837FD227593D0BF391|csbX]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCACCGCCTACT,  downstream forward: _UP4_TAGCCTCTTTGGTCAAACTA
BKK27760 ([gene|12B260DBC4E29151364251837FD227593D0BF391|csbX]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCACCGCCTACT,  downstream forward: _UP4_TAGCCTCTTTGGTCAAACTA
References
9099855,22900538,11544224

12B260DBC4E29151364251837FD227593D0BF391

Page visits: 1413

Time of last update: 2022-01-20 14:29:54

Author of last update: Melvin.boenninger