bdbB

bdbB
168

thiol-disulfide oxidoreductase

locus
BSU_21440
Molecular weight
17.00 kDa
pI
9.41
Protein length
Gene length
function
oxidative folding of proteins
product
thiol-disulfide oxidoreductase
essential
no
synonyms
bdbB, yolK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1495

This gene is a member of the following regulons

Gene
Coordinates
2,265,225  2,265,671
The protein
Catalyzed reaction/ biological activity
oxidative folding of [protein|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA] (together with [protein|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|bdbC])
Protein family
DsbB family (with [protein|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|bdbC], according to UniProt)
Structure
[AF|P68571]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|260693EE7F5B5CE2A141149D292405E84B7A5FF4|sunT]-[gene|DB5F719C0A2F610301E174F6890DA9E826C76932|bdbA]-[gene|6B2DC9873B7B693D9D0FC0D773740140D0640C9E|sunS]-[gene|12CE5AE0BD02C989E803480A1CE5A47D6192D751|bdbB]
description
[Pubmed|22383849]
regulation
repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]-[wiki|DnaA] [Pubmed|27902860,15743949]
expression starts in the stationary phase [pubmed|30808982]
expression is heterogeneous in the population, this is mediated by [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok], and [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A] [pubmed|30808982]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]: activation, [Pubmed|20817675,19465659], in [regulon|protein:5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh regulon]
[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA] [Pubmed|27902860,15743949], in [regulon|protein:6740108089F13116F200C15F35C2E7561E990FEB|dnaA regulon]
[protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]: activation, [Pubmed|16306698], in [regulon|protein:7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
the mRNA is very stable (> 15 min) [pubmed|12884008]
the amount of the mRNA is substantially decreased upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]→[gene|12CE5AE0BD02C989E803480A1CE5A47D6192D751|bdbB]

2022-11-26 01:28:20

Jstuelk

46

173a6d1c6c62ab55ab2900d516e97b549076ae97

85D1B8FA2F46C6C22D4D5CAD32F0080E33BACFA0

Biological materials
Mutant
BKE21440 ([gene|12CE5AE0BD02C989E803480A1CE5A47D6192D751|bdbB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAATGATTTTACATATCTTG,  downstream forward: _UP4_TGAATAAGAAGTAACCCGCC
BKK21440 ([gene|12CE5AE0BD02C989E803480A1CE5A47D6192D751|bdbB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAATGATTTTACATATCTTG,  downstream forward: _UP4_TGAATAAGAAGTAACCCGCC
References
Reviews
25212246
Original Publications
27902860,11872755,15743949,20817675

12CE5AE0BD02C989E803480A1CE5A47D6192D751

Page visits: 2356

Time of last update: 2022-12-03 19:01:09

Author of last update: Melvin.boenninger