yokI

yokI
168

LXG toxin, non-specific metal-dependent DNase

locus
BSU_21580
Molecular weight
64.12 kDa
pI
5.76
Protein length
Gene length
function
competetion with other bacteria in biofilms
product
LXG toxin, DNase
essential
no
ec
null
synonyms
yokI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5444

This gene is a member of the following regulons

Gene
Coordinates
2,275,706  2,277,421
Phenotypes of a mutant
the mutant is outcompeted by wild type cells in biofilms [pubmed|34280190]
The protein
[wiki|Domains]
[wiki|LXG domain] (aa 1-235) (according to UniProt)
Structure
[AF|O31998]
[wiki|Localization]
secreted
secretion and delivery requires [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|WXG100] and the T7SS ([protein|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[protein|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|essB]-[wiki|YukB]-[wiki|YueB]-[wiki|YueC]-[protein|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]) [pubmed|34280190]
Expression and Regulation
Operons
genes
[gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]-[gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]-[gene|8BA8DB1483190AB847F28F3E56C247FE85C3225E|yokK]-[gene|9A03964C94A9253B3D9AAA60ACA0651AED49A627|yokL]
description
[Pubmed|20817675]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|search|yolA]' and '[protein|search|yokL]' [PubMed|20525796]
Open in new tab

[gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]→[gene|9A03964C94A9253B3D9AAA60ACA0651AED49A627|yokL]

2022-11-27 22:00:24

ghost

44

c0991145616d1ecd9ca254c77d6417772671b6cd

0031AF5FF8A7ECE1B60F8B6A925BF05711BF39E6

Biological materials
Mutant
BKE21580 ([gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCTCCTTTCAAG,  downstream forward: _UP4_AACTTTAGAAAGTAGGTGCG
BKK21580 ([gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCTCCTTTCAAG,  downstream forward: _UP4_AACTTTAGAAAGTAGGTGCG
References
22200572,20817675,34280190

13C081250872E72C61C49D8F77AC5AF4B6D431A3

Page visits: 1545

Time of last update: 2022-11-30 01:59:25

Author of last update: Jstuelk