SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


polyketide synthase

Molecular weight
562.00 kDa
Protein length
Gene length
polyketide synthesis
polyketide synthase
pksJ, pksK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4908

This gene is a member of the following regulons

1,792,806  1,807,937
The protein
Protein family
[wiki|ATP-dependent AMP-binding enzyme family] (according to UniProt)
5 [wiki|Carrier domain]s (aa 590-667, aa 1654-1729, aa 3114-3188, aa 3212-3286, aa 4459-4536) (according to UniProt)
[PDB|4NA1] [Pubmed|24508341]
Expression and Regulation
expressed during the transition from growth to stationary phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|24187085]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab


2022-01-13 13:48:32





Open in new tab


2022-01-19 07:54:47





Biological materials
BKE17180 ([gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTGCCTCCATTTC,  downstream forward: _UP4_ACTGCGGCAAACATATGGGA
BKK17180 ([gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTGCCTCCATTTC,  downstream forward: _UP4_ACTGCGGCAAACATATGGGA


Page visits: 1720

Time of last update: 2022-01-20 08:55:38

Author of last update: Melvin.boenninger