SubtiWiki SubtiWiki
yxaH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yxaH
168

putative transporter

locus
BSU_39970
Molecular weight
46.04 kDa
pI
9.95
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yxaH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2311

This gene is a member of the following regulons

Gene
Coordinates
4,104,929  4,106,137
The protein
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]
description
[Pubmed|10746760]
regulation
induced by flavonoids such as quercetin ([protein|search|QdoR], [protein|search|LmrA]) [Pubmed|17483215]
regulatory mechanism
[protein|52D560AA02F0849CB24460A496021560063B2E12|lmrA]: repression, [Pubmed|15317768], in [regulon|protein:52D560AA02F0849CB24460A496021560063B2E12|lmrA regulon]
[protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]: repression, [Pubmed|17483215], in [regulon|protein:47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR regulon]
additional information
major regulator: [protein|search|QdoR] [PubMed|17483215]
Open in new tab

[gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]→[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]

2021-11-13 11:33:34

ghost

7

c14e762fec9f4cbec17fdbace8ff20295b9c49d0

C80841584C27E4DC50FE3CA20B59B16E53149C1B

Biological materials
Mutant
MGNA-B685 (yxaH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1684 NBRP B. subtilis, Japan]
BKE39970 ([gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCCATCACGCTCCTTT,  downstream forward: _UP4_TAGATGCCTATTGGCGTCTA
BKK39970 ([gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCCATCACGCTCCTTT,  downstream forward: _UP4_TAGATGCCTATTGGCGTCTA
References
10746760,15317768,17483215

142444E1167BA7428EB95E4418C839ADF3E728B0

Page visits: 988

Time of last update: 2022-01-02 02:15:18

Author of last update: Melvin.boenninger