fbpB

fbpB
168

[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]-regulated basic protein, acts as RNA chaperone for [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA], response to iron limitation

locus
BSU_04530
Molecular weight
6.88 kDa
pI
10.73
Protein length
Gene length
function
RNA chaperone
product
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]-regulated basic protein, acts as RNA chaperone for [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA], response to iron limitation
essential
no
synonyms
fbpB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
506,322  506,501
Phenotypes of a mutant
transcription profile of a ''[gene|35ABF185A1AD60E21ECF32AF9D01123307B5152D|fbpA] [gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]'' double mutant strain: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE27416 GEO] [Pubmed|22389480]
The protein
Structure
[AF|P96609]
Expression and Regulation
Operons
genes
[gene|35ABF185A1AD60E21ECF32AF9D01123307B5152D|fbpA]-[gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]
description
[pubmed|18697947]
regulation
induced by iron starvation (third wave, under extreme starvation, iron sparing response) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [pubmed|29133393,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab

[gene|35ABF185A1AD60E21ECF32AF9D01123307B5152D|fbpA]→[gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]

2022-08-30 07:39:32

Jstuelk

14

c29b47bb54dec5bcee92f31d44ac34167dbc213f

E9A37C872FE568D856C0DD639BDD933DE20BBE24

Biological materials
Mutant
BKE04530 ([gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTAACTCCGTCAGC,  downstream forward: _UP4_TAAAAAGAGCCGGTAAGGCT
BKK04530 ([gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTAACTCCGTCAGC,  downstream forward: _UP4_TAAAAAGAGCCGGTAAGGCT
References
12354229,18697947,20525796,22389480,22427629,29133393

147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90

Page visits: 2956

Time of last update: 2022-10-06 10:44:45

Author of last update: Jstuelk