SubtiWiki SubtiWiki
spbK

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

spbK
168

protection of populations of ICEBs1 host cells from predation by the lysogenic phage SPβ

locus
BSU_05000
Molecular weight
31.14 kDa
pI
5.18
Protein length
Gene length
function
unknown
product
protection of populations of ICEBs1 host cells from predation by the lysogenic phage SPβ
essential
no
ec
null
synonyms
yddK

Genomic Context

Categories containing this gene/protein

This gene is a member of the following regulons

Gene
Coordinates
546,166  546,966
Expression and Regulation
Operons
genes
[gene|14D2E2F76ED01CC9B2B080740B0046648F64A888|spbK]
description
[pubmed|22383849]
Open in new tab

[gene|14D2E2F76ED01CC9B2B080740B0046648F64A888|spbK]

2021-08-17 21:50:52

Jstuelk

2

b2ca2308c674221392ef9522dc01665f941c1cb0

4611CCF960EE390C22A14B0474D9D222097BDD17

Biological materials
Mutant
BKE05000 ([gene|14D2E2F76ED01CC9B2B080740B0046648F64A888|spbK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAGATTTCCTCCGACCT,  downstream forward: _UP4_TAACTTAAATGCCACTGCTA
BKK05000 ([gene|14D2E2F76ED01CC9B2B080740B0046648F64A888|spbK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAGATTTCCTCCGACCT,  downstream forward: _UP4_TAACTTAAATGCCACTGCTA

14D2E2F76ED01CC9B2B080740B0046648F64A888

Page visits: 1088

Time of last update: 2022-01-26 21:03:47

Author of last update: Jstuelk