leuA

leuA
168

2-isopropylmalate synthase

locus
BSU_28280
Molecular weight
56.74 kDa
pI
5.66
Protein length
Gene length
function
biosynthesis of leucine
product
2-isopropylmalate synthase
essential
no
ec
2.3.3.13
synonyms
leuA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0119

This gene is a member of the following regulons

Gene
Coordinates
2,892,138 2,893,694
The protein
Catalyzed reaction/ biological activity
3-methyl-2-oxobutanoate + acetyl-CoA + H2O --> (2S)-2-isopropylmalate + CoA + H+ (according to UniProt)
Protein family
alpha-IPM synthase/homocitrate synthase family (single member, according to UniProt)
[wiki|Domains]
Pyruvate carboxyltransferase domain (aa 4-266) (according to UniProt)
Structure
[PDB|3EEG] (from ''Cytophaga hutchinsonii atcc 33406'', 53% identity, 68% similarity)
[AF|P94565]
[wiki|Localization]
cytoplasm (according to UniProt)
membrane [Pubmed|18763711]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]-[gene|49E2D2EE480C2FFDED0C35E3AF0DBED5AD819B5F|ilvH]-[gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]-[gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA]-[gene|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB]-[gene|AC459429A9C50463FD947C1CF9EA919B6FE3B335|leuC]-[gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]
description
[Pubmed|1577690]
regulation
expression is stimulated in the presence of glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [PubMed|12193635]
regulatory mechanism
T-box: termination/antitermination, via tRNA controlled [wiki|RNA switch], repression by BCAA, in [regulon|other_regulator:T-box|T-box]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|15547269], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: activation, [Pubmed|12193635], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1577690], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An [wiki|ncRNA|antisense RNA] is predicted for [gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA] [PubMed|20525796]
the [wiki|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
Open in new tab

[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]→[gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]

2022-12-01 04:50:45

Jstuelk

36

905a0fc4b9e1945f65cf0820ea8bda45e4ac716c

931C13BE07545B8037A118810CF4C8E29210A7CE

Biological materials
Mutant
BKE28280 ([gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCACGAAGCGTCGTATCGA, downstream forward: _UP4_TAAAAGAAAGGAGAACGGTT
BKK28280 ([gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCACGAAGCGTCGTATCGA, downstream forward: _UP4_TAAAAGAAAGGAGAACGGTT
References
15060025,12193635,19258532,8289305,18641142,20525796,15547269,12618455,12107147,18763711,25157083,20935095,24163341,15378759,25755103,26220295

1502AED337F59DFFCEAFF68FE111C5AA6155701B

Page visits: 2982

Time of last update: 2022-12-01 09:51:01

Author of last update: Melvin.boenninger