radA

radA
168

branch migration transferase, 6-O-methylguanine-DNA methyltransferase, negative effector of [protein|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] activity, participates in the stabilization and/or processing of holliday junction intermediates, required for repair-by-recombination, crucial for the [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]-dependent acquisition of homologous genes from related species by natural transformation

locus
BSU_00870
Molecular weight
49.32 kDa
pI
8.13
Protein length
Gene length
function
homologous recombination, control of c-di-AMP formation, co-ordination of responses to replicative stress and genetic recombination
product
branch migration transferase, 6-O-methylguanine-DNA methyltransferase
essential
no
synonyms
radA, sms, yacJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1066

This gene is a member of the following regulons

Gene
Coordinates
106,096  107,472
Phenotypes of a mutant
reduced spore survival after infrared exposure [pubmed|28961460]
sensitive to mitomycin C and H2O2-induced DNA damage [pubmed|30877841]
reduced formation of [gene|F1969E4C7BAAF70BCBE570F58350C12A3E417539|rpsB] or [gene|144D952B05EBBFF41EC92DF906543EA00475FE69|rpsE] suppressor mutants after mitomycin treatment [pubmed|34339280]
impaired in transformation with chromosomal DNA [pubmed|30877841]
no transformation with chromosomal DNA in [gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] mutant cells [pubmed|31350886]
The protein
Catalyzed reaction/ biological activity
reduces the activity of [protein|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] [pubmed|23760274]
binds ssDNA and Holliday junctions (preferentially over dsDNA) [pubmed|30877841]
promotes [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]-mediated DNA strand exchange [pubmed|30877841]
ATPase and 5' --> 3' DNA helicase activity [pubmed|30877841]
unwinds forked DNA in the 5′→3′ direction [pubmed|31350886]
Protein family
RecA family (together with [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]) (according to UniProt)
[wiki|Domains]
N-terminal zinc finger (aa 10 ... 27) (according to UniProt)
central RecA-like ATPase domain (according to UniProt)
KNRFG motif (aa 255 ... 259) (according to UniProt)
C-terminal Lon domain (aa 354 ... 458) (according to UniProt)
Structure
[PDB|5LKM] (from Streptococcus pneumoniae, 63% identity) [pubmed|28561029]
[AF|P37572]
[wiki|Localization]
cytoplasm (according to UniProt)
Expression and Regulation
Operons
genes
[gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]-[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]-[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
description
[Pubmed|8793870]
regulation
expressed during germination and spore outgrowth [Pubmed|24244006]
regulatory mechanism
[protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|protein:908DB17A39D518E84977250C55825E77FA02E391|ctsR regulon]
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, [pubmed|30962353], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|17434969], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8793870], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]→[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]

2022-11-27 15:18:10

Bzhu

54

b7066b5ca5004b095502d71420c469e9ee925bfa

163769A1708F45F8ABE642374A97FA8A00293529

Biological materials
Mutant
MGNA-B931 (yacJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1930 NBRP B. subtilis, Japan]
BKG1 (''[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]''::''spc''), available in [wiki|Jörg Stülke]'s lab
BKG2 (''[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::spc''), available  in [wiki|Jörg Stülke]'s lab
BKE00870 ([gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATAGTGTAAGACCTC,  downstream forward: _UP4_CGTACTTCATTAGGAGGATA
BKK00870 ([gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATAGTGTAAGACCTC,  downstream forward: _UP4_CGTACTTCATTAGGAGGATA
Expression vectors
pGP2693: expression in ''E. coli'', with C-terminal Strep-tag, in [wiki|pGP574], available in [wiki|Jörg Stülke]'s lab
References
Reviews
26459995
Original Publications
8793870,9987115,15317759,23760274,11544224,25484163,11810266,28511132,28961460,28561029,26845522,30877841,31350886,33264457,34339280,34880841

151F226370D225776F3FE7EA4901485095F1AC45

Page visits: 2827

Time of last update: 2022-12-06 10:22:34

Author of last update: Jstuelk