trpA

trpA
168

tryptophan synthase (alpha subunit)

locus
BSU_22630
Molecular weight
29.30 kDa
pI
4.82
Protein length
Gene length
function
biosynthesis of tryptophan
product
tryptophan synthase (alpha subunit)
essential
no
ec
4.2.1.20
synonyms
trpA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0159

This gene is a member of the following regulons

Gene
Coordinates
2,371,508  2,372,311
The protein
Catalyzed reaction/ biological activity
(1S,2R)-1-C-(indol-3-yl)glycerol 3-phosphate + L-serine --> D-glyceraldehyde 3-phosphate + H2O + L-tryptophan (according to UniProt)
Protein family
TrpA family (single member, according to UniProt)
Structure
[PDB|1WQ5] (from ''Escherichia coli'', 35% identity, 53% similarity) [Pubmed|15667212]
[AF|P07601]
Expression and Regulation
Operons
genes
[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
description
[Pubmed|21815947]
regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: termination/antitermination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab

[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]→[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]

2022-11-27 04:01:30

Jstuelk

24

53eef6e8739e58d1bed57b78e584c86a2e6ff379

37D11B58C2266E362D5C193ADEA68D53F64A90E3

genes
[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
description
[Pubmed|21815947]
regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: termination/antitermination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab

[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]→[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]

2022-11-30 22:01:33

Jstuelk

30

a3b37416002f0f1e65847bd8d15ba18b53400752

AA88BDB7192FA5467301E36C102EEEBB21BEDA86

Biological materials
Mutant
BKE22630 ([gene|155FE26C148F7022948DD7539533AB6876571862|trpA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTTCTGATGGTTGAAGAT,  downstream forward: _UP4_TACAGTTTAAAATGAGGTGA
BKK22630 ([gene|155FE26C148F7022948DD7539533AB6876571862|trpA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTTCTGATGGTTGAAGAT,  downstream forward: _UP4_TACAGTTTAAAATGAGGTGA
References
Reviews
18486479,11893063,11163353,7900177,19387555,12859215,11395405,12966138
Original Publications
14976255,3924737,6436812,2422155,8419914,1551827,21815947,31871208

155FE26C148F7022948DD7539533AB6876571862

Page visits: 2537

Time of last update: 2022-12-02 16:48:01

Author of last update: Jstuelk