SubtiWiki SubtiWiki
oxdD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

oxdD
168

oxalate decarboxylase, inner spore coat protein

locus
BSU_18670
Molecular weight
43.39 kDa
pI
5.36
Protein length
Gene length
function
protection of the spore
product
oxalate decarboxylase
essential
no
ec
4.1.1.2
synonyms
oxdD, yoaN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2140

This gene is a member of the following regulons

Gene
Coordinates
2,037,601  2,038,779
The protein
Catalyzed reaction/ biological activity
H+ + oxalate --> CO2 + formate (according to UniProt)
Structure
[PDB|1L3J] ([protein|9793E952C985BA268AC28C907900A03F4E8A3253|oxdC], 59% identity) [pubmed|14871895]
Paralogous protein(s)
[protein|9793E952C985BA268AC28C907900A03F4E8A3253|oxdC]
[wiki|Localization]
inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA]  [Pubmed|22171814]
Expression and Regulation
Operons
genes
[gene|1568DD457FDD482B3C14954A95F62BE338CBD15D|oxdD]
description
[Pubmed|14973022]
regulation
expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|14973022]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: repression, [Pubmed|14973022], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190,14973022], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|1568DD457FDD482B3C14954A95F62BE338CBD15D|oxdD]

2021-07-15 04:39:11

ghost

4

e773da7cc66a1f582d8e8ebeee5c0c94f65f75cb

810CEA49BC27DDBCD30A40B8382FE31840AF4EBC

Biological materials
Mutant
MGNA-A842 (yoaN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/842 NBRP B. subtilis, Japan]
BKE18670 ([gene|1568DD457FDD482B3C14954A95F62BE338CBD15D|oxdD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCGTTTTAGAAA,  downstream forward: _UP4_TAAAGACGTAACAGATCACA
BKK18670 ([gene|1568DD457FDD482B3C14954A95F62BE338CBD15D|oxdD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCGTTTTAGAAA,  downstream forward: _UP4_TAAAGACGTAACAGATCACA
References
Reviews
20464388,23202530
Original Publications
11546787,15699190,14973022,20601499,22171814,14871895,28870294

1568DD457FDD482B3C14954A95F62BE338CBD15D

Page visits: 1322

Time of last update: 2021-12-06 10:34:17

Author of last update: Melvin.boenninger