yrkP

yrkP
168

two-component response regulator ([wiki|OmpR family])

locus
BSU_26430
Molecular weight
26.65 kDa
pI
5.69
Protein length
Gene length
function
unknown
product
two-component response regulator ([wiki|OmpR family])
essential
no
synonyms
yrkP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0745

This gene is a member of the following regulons

Gene
Coordinates
2,704,435  2,705,130
The protein
Protein family
[wiki|OmpR family] of two-component response regulators
[wiki|Domains]
[wiki|Response regulatory domain] (aa 4-116) (according to UniProt)
Structure
[PDB|2OQR] (RegX3 from Mycobacterium tuberculosis, 38% identity) [pubmed|17942407]
[AF|P54443]
Modification
phosphorylated by [protein|8A38FEFAA0FF91D989B77D40CBB3741902DC9D67|yrkQ] on an Asp residue
Effectors of protein activity
phosphorylation likely affects DNA-binding activity
Expression and Regulation
Operons
genes
[gene|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]-[gene|8A38FEFAA0FF91D989B77D40CBB3741902DC9D67|yrkQ]-[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]
description
[Pubmed|18175906]
regulatory mechanism
[protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]: activation, [Pubmed|18175906], in [regulon|protein:1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP regulon]
Open in new tab

[gene|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]→[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]

2022-11-28 19:16:54

ghost

14

e3d063de09cd9c4d97c8ec82b566de3adad28a57

9CC2987CFD31A5505E51ACD9A4B0D933B757785A

Biological materials
Mutant
BKE26430 ([gene|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCTCTCACCTCATG,  downstream forward: _UP4_CGATTTGGCGCATCTTAAAT
BKK26430 ([gene|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCTCTCACCTCATG,  downstream forward: _UP4_CGATTTGGCGCATCTTAAAT
References
10094672,18175906,23504016,17942407

1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9

Page visits: 1853

Time of last update: 2022-11-29 16:13:57

Author of last update: Melvin.boenninger