immA

immA
168

protease, degrades [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR] at a specific site

locus
BSU_04810
Molecular weight
19.26 kDa
pI
8.38
Protein length
Gene length
function
control of [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR] activity
product
site-specific protease
essential
no
synonyms
immA, ydcM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2856

This gene is a member of the following regulons

Gene
Coordinates
530,624  531,133
The protein
Structure
[AF|P96630]
Expression and Regulation
Operons
genes
[gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]-[gene|1599BBAC05EB62A847F73572CD777BC472301DE8|immA]-[gene|47AE982C5E71F31B5AF04C4F50593C2629F8EDAF|int]
description
[pubmed|22383849]
Open in new tab

[gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]→[gene|47AE982C5E71F31B5AF04C4F50593C2629F8EDAF|int]

2022-12-29 09:01:19

Jstuelk

34

ba0e2f39102d664109ce21216f6467994f787a85

0DD14B00F33C60A47598A1CB94B89B6408385882

Biological materials
Mutant
BKE04810 ([gene|1599BBAC05EB62A847F73572CD777BC472301DE8|immA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCTTTGCTTGTATAAATTG,  downstream forward: _UP4_GCTTTTGGTTAAAGGAGAAA
BKK04810 ([gene|1599BBAC05EB62A847F73572CD777BC472301DE8|immA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCTTTGCTTGTATAAATTG,  downstream forward: _UP4_GCTTTTGGTTAAAGGAGAAA
References
Reviews
34410368
Original Publications
21036995,18761623

1599BBAC05EB62A847F73572CD777BC472301DE8

Page visits: 1425

Time of last update: 2023-02-01 11:55:28

Author of last update: Jstuelk