nasF

nasF
168

uroporphyrinogen methyltransferase

locus
BSU_03280
Molecular weight
53.70 kDa
pI
6.52
Protein length
Gene length
function
nitrate respiration
product
uroporphyrinogen methyltransferase
essential
no
ec
2.1.1.107
synonyms
nasF, nasBE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1587

This gene is a member of the following regulons

Gene
Coordinates
353,900  355,351
The protein
Catalyzed reaction/ biological activity
2 S-adenosyl-L-methionine + uroporphyrinogen III --> H+ + precorrin-2 + 2 S-adenosyl-L-homocysteine (according to UniProt)
Protein family
precorrin methyltransferase family (with [protein|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD], according to UniProt)
Structure
[PDB|1PJQ] (CysG from ''Salmonella enterica'', 46% identity to N-terminal domain) [Pubmed|14595395]
[AF|P42437]
Paralogous protein(s)
[protein|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD], (corresponds to N-terminal domain of NasF)
Expression and Regulation
Operons
genes
[gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]-[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]-[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
description
[Pubmed|7836289]
regulation
''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
regulatory mechanism
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|10972836], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [PubMed|8799114,9765565], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|EC6697D5D945B7E5083AFED9218748763C443278|nsrR]: repression, [Pubmed|16885456], in [regulon|protein:EC6697D5D945B7E5083AFED9218748763C443278|nsrR regulon]
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7836289], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]→[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]

2022-11-14 23:45:34

ghost

32

f7e39891ce616efe86a59a87e70448f347bb9239

B3FDABF6DE6A38B053CBE30BA36088850B35E312

genes
[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
description
[Pubmed|9765565]
regulation
''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
Open in new tab

[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]→[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]

2022-11-20 05:31:15

ghost

24

5ad87c79ecdfd1b1041c676834950d8393689a20

E10C8C0393696A6DF68E202566914889ADC48A5C

Biological materials
Mutant
BKE03280 ([gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCCTTCCGTCACT,  downstream forward: _UP4_TGATGGCAAGCAGCCCTTTT
BKK03280 ([gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCCTTCCGTCACT,  downstream forward: _UP4_TGATGGCAAGCAGCCCTTTT
References
Reviews
22103536
Original Publications
10217486,12823818,24214949,8799114,9765565,10972836,16885456,7868621,21091510,25755103,14595395

159A6D0D45B5F0F055228357FD9A3BF8E5A999E5

Page visits: 1955

Time of last update: 2022-11-27 10:43:44

Author of last update: Melvin.boenninger