yfiR

yfiR
168

transcriptional regulator ([wiki|TetR family]) of the [gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]-[gene|search|yfiR ]operon

locus
BSU_08370
Molecular weight
23.54 kDa
pI
5.02
Protein length
Gene length
function
control of [gene|search|yfiS ]expression
product
transcriptional regulator ([wiki|TetR family])
essential
no
synonyms
yfiR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

Gene
Coordinates
911,964  912,581
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 11-71) (according to UniProt)
Structure
[PDB|1RKT] [Pubmed|16862575]
[AF|O31560]
Expression and Regulation
Operons
genes
[gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]-[gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]
description
(according to [http://dbtbs.hgc.jp/COG/prom/yfiSR.html DBTBS]) null
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|25755103], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|15DE8BAFB36296B5842E283C836D600755786397|yfiR]: repression, [pubmed|], in [regulon|protein:15DE8BAFB36296B5842E283C836D600755786397|yfiR regulon]
Open in new tab

[gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]→[gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]

2022-05-22 18:47:38

ghost

7

e2db64fbbffe2c820143dd4511a162c28df1e168

8E2244D7A5B8A3B84C851A9EE6C6949347A52F91

genes
[gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]
description
[Pubmed|22383849]
Open in new tab

[gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]

2022-05-22 19:14:34

ghost

4

02f97f21cfbb9bcd12a88d2d08d1ce3be27ee321

C603880A88D6FC9EB7126C5DDE0C0223FCA54297

Biological materials
Mutant
MGNA-C356 (yfiR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2354 NBRP B. subtilis, Japan]
BKE08370 ([gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTTATCCTTGTGCTCCTTT,  downstream forward: _UP4_TAAAGAAACGCGGCAGGAGC
BKK08370 ([gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTTATCCTTGTGCTCCTTT,  downstream forward: _UP4_TAAAGAAACGCGGCAGGAGC
References
Reviews
24006471
Original Publications
25755103,16862575,22383849

15DE8BAFB36296B5842E283C836D600755786397

Page visits: 876

Time of last update: 2022-06-23 00:52:39

Author of last update: Melvin.boenninger