sfp/2
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

sfp/2
168

4-phosphopantetheinyl transferase (surfactin synthetase-activating enzyme), inactive pseudogene in strain 168

locus
BSU_03570
Protein length
Gene length
function
phosphopantetheinylates a serine residue in each of the seven peptidyl carrier protein domains of the first three subunits of surfactin synthetase (SrfAA-SrfAB-SrfAC) and AcpK
product
4-phosphopantetheinyl transferase
essential
no
ec
null
synonyms
sfp\/2, sfp

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
407,638  408,135
Phenotypes of a mutant
No swarming motility on B medium. [Pubmed|19202088]
The protein
Catalyzed reaction/ biological activity
CoA + apo-[peptidyl-carrier protein] = adenosine 3',5'-bisphosphate + holo-[peptidyl-carrier protein] (according to Swiss-Prot)
Protein family
P-Pant transferase superfamily (with [protein|200BE4802FCE3C860565B374EAADC9C1FEEF3E49|acpS], according to UniProt)
Structure
[PDB|4MRT] [pubmed|24704508]
Biological materials
Mutant
BKE03570 ([gene|1627167E7E9DBE444161A94D9F76317612C6401C|sfp/2]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAGATCCTCCGTCTG,  downstream forward: _UP4_ATCGCTTCCGCTTGATTCCT
BKK03570 ([gene|1627167E7E9DBE444161A94D9F76317612C6401C|sfp/2]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAGATCCTCCGTCTG,  downstream forward: _UP4_ATCGCTTCCGCTTGATTCCT
labs
[wiki|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
References
Reviews
20735481,24704508
Original Publications
15955059,19202088,2848009,11489886,15065855,10581256,15066026,11867633,19202088,19749039,20094656,9484229,20148996,21278284,21466506

1627167E7E9DBE444161A94D9F76317612C6401C

Page visits: 1371

Time of last update: 2022-08-08 14:56:29

Author of last update: Jstuelk