SubtiWiki SubtiWiki
yoaJ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yoaJ
168

bacterial expansin, binds cellulose, required for the colonization of maize roots

locus
BSU_18630
Molecular weight
25.49 kDa
pI
9.45
Protein length
Gene length
function
interaction with plant roots
product
expansin
essential
no
synonyms
yoaJ, EXLX1

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4305

This gene is a member of the following regulons

Gene
Coordinates
2,032,927  2,033,625
Phenotypes of a mutant
strongly reduced ability to colonize maize  roots [Pubmed|18971341]
The protein
Protein family
expansin [Pubmed|18971341]
[wiki|Domains]
Expansin-like EG45 domain (aa 58-127) (according to UniProt)
Structure
[PDB|3D30] [Pubmed|18971341]
[wiki|Localization]
extracellular [Pubmed|18971341]
Expression and Regulation
Operons
genes
[gene|17094CBA2DDFB82B5FC064AADB85DAB60A15B2C0|yoaJ]
description
[Pubmed|12354229]
regulation
induced upon iron starvation ([protein|search|Fur]) [Pubmed|12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab

[gene|17094CBA2DDFB82B5FC064AADB85DAB60A15B2C0|yoaJ]

2021-12-22 12:04:34

ghost

5

61d603e28fa56e14adc51f323763d3e2bd32d284

624A5280936065F93E1FEE45FE637EC60E9ED4E4

Biological materials
Mutant
MGNA-A839 (yoaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/839 NBRP B. subtilis, Japan]
BKE18630 ([gene|17094CBA2DDFB82B5FC064AADB85DAB60A15B2C0|yoaJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTGGTCCTCCTCAAA,  downstream forward: _UP4_TAAAAAATACGAAACAGCGG
BKK18630 ([gene|17094CBA2DDFB82B5FC064AADB85DAB60A15B2C0|yoaJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTGGTCCTCCTCAAA,  downstream forward: _UP4_TAAAAAATACGAAACAGCGG
References
Reviews
25833181,27365165
Original Publications
19058186,15604683,16984999,22927418,18971341,21454649,12354229,23053073,24755657,22949138,26521249,26751268,27365165,30221235,31271651,31689330

17094CBA2DDFB82B5FC064AADB85DAB60A15B2C0

Page visits: 1479

Time of last update: 2022-01-20 22:01:17

Author of last update: Jstuelk