yacP

yacP
168

[wiki|ribosome]-associated A site endoribonuclease

locus
BSU_00970
Molecular weight
19.53 kDa
pI
7.28
Protein length
Gene length
function
ribosome-dependent mRNA decay
product
A site endoribonuclease
essential
no
synonyms
yacP, rae1

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3688

This gene is a member of the following regulons

Gene
Coordinates
116,025  116,537
The protein
[wiki|Domains]
N-terminal NYN domain [pubmed|28363943,17114934]
C-terminal flexible RNA-binding domain [pubmed|28363943]
Structure
[PDB|5MQ8] [pubmed|28363943]
[AF|P37574]
Expression and Regulation
Operons
genes
[gene|132E91DB8C81CD8C4F5160B2C068B74DA10AE224|gltX]-[gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE]-[gene|E5826A99769E2FE45959A9D623D6467A8DDDEB81|cysS]-[gene|031FDF8443A8A4D5B042B7591EBE2E6C74F07702|mrnC]-[gene|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|yacO]-[gene|172652156ABFE72D5BAAC22729CE17CA947538B5|yacP]
description
[Pubmed|7510287]
regulation
expression transiently increases in the forespore [Pubmed|22848659]
the [wiki|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
T-box: transcription antitermination, overlaps a transcription terminator upstream of [gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE], in [regulon|other_regulator:T-box|T-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7510287], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|132E91DB8C81CD8C4F5160B2C068B74DA10AE224|gltX]→[gene|172652156ABFE72D5BAAC22729CE17CA947538B5|yacP]

2022-11-24 18:26:23

Jstuelk

26

9ab774439b3983729fe5811aeaf44f4bc16c609f

BCC6FA512C81F405B92E34AE44A52F949D245F3D

Biological materials
Mutant
MGNA-B885 (yacP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1884 NBRP B. subtilis, Japan]
BKE00970 ([gene|172652156ABFE72D5BAAC22729CE17CA947538B5|yacP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGGTCTTTATTCTCCCA,  downstream forward: _UP4_TAAGTTGACGCTTTTTTGCC
BKK00970 ([gene|172652156ABFE72D5BAAC22729CE17CA947538B5|yacP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGGTCTTTATTCTCCCA,  downstream forward: _UP4_TAAGTTGACGCTTTTTTGCC
References
Reviews
28396493,29557713
Original Publications
19258532,28363943,17114934

172652156ABFE72D5BAAC22729CE17CA947538B5

Page visits: 1623

Time of last update: 2022-11-27 21:12:05

Author of last update: Jstuelk