

small acid-soluble spore protein (minor)

Molecular weight
5.29 kDa
Protein length
Gene length
protection of spore DNA
small acid-soluble spore protein (minor)
sspO, cotK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5860

This gene is a member of the following regulons

1,926,306  1,926,452
The protein
Protein family
sspO family (single member, according to UniProt)
spore core (according to Swiss-Prot)
Expression and Regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|10806362]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|10806362], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab


2022-12-24 04:07:18





additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
BKE17990 ([gene|174047392BCCE4D57528ED78866626252BBF10D2|sspO]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATTATCACCTCAATCA,  downstream forward: _UP4_TAACACCGAACTCTTTTAAG
BKK17990 ([gene|174047392BCCE4D57528ED78866626252BBF10D2|sspO]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATTATCACCTCAATCA,  downstream forward: _UP4_TAACACCGAACTCTTTTAAG


Page visits: 1458

Time of last update: 2023-02-05 17:47:16

Author of last update: Melvin.boenninger