yotF

yotF
168

similar to 3-hydroxy-3-methylglutaryl-CoA lyase

locus
BSU_19900
Molecular weight
2.88 kDa
pI
3.87
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yotF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

The protein
Structure
[AF|O31869]
Expression and Regulation
Operons
genes
[gene|AFCA823BA7245A295B3282602A928D2CD0F8CD27|yosX]-[gene|B604367A80B7D3DF4A940C12A35EDF37B0E415F2|yotB]-[gene|6416197EF316D74998012765EF9819072C38D2E2|yotC]-[gene|470037C34BD5D3EB5BDAD85BD4178ABDB6330A62|yotD]-[gene|5C8815965146BCD8ED238258B3F820AA17241165|yotE]-[gene|177BAE8E5143CBE479B8EF6814F2A1066E72D658|yotF]-[gene|CE176CE32089F79C9BAC36641DDBBA8C9C38C957|yotG]-[gene|5240CC5115326ACBB2B73F7610987C842C246F24|yotH]-[gene|ADFAFAB949F0BED0681E35C3055DB0984DA7910E|yotI]-[gene|C5508537A5CB1E2F71329CD822242EE988D395F3|yotJ]-[gene|3C740F35E67CDD7FB6BF19E0FF43F973D254EF3E|yotK]-[gene|3899DF460037B569066F452EC50AD97672AA5ACA|yotM]-[gene|46826326719EB32B5733953EC090FD91CB59C5B6|sprB]
description
[Pubmed|25299644]
regulation
''[protein|search|sprB]'': expressed during the middle and late stages of [wiki|sporulation] [Pubmed|25299644]
regulatory mechanism
[protein|6977F18870004AD236539D9409255815E6BE9241|csoR]: repression, [Pubmed|20233928], in [regulon|protein:6977F18870004AD236539D9409255815E6BE9241|csoR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25299644], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|25299644], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|AFCA823BA7245A295B3282602A928D2CD0F8CD27|yosX]→[gene|46826326719EB32B5733953EC090FD91CB59C5B6|sprB]

2022-11-23 06:11:52

ghost

23

d73f87b6e78327070acca915e541f23c48175330

06DE073536CD2A3CA0923FA8B10B026964721DB2

Biological materials
Mutant
BKE19900 ([gene|177BAE8E5143CBE479B8EF6814F2A1066E72D658|yotF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAATCCCTCCTTGTAC,  downstream forward: _UP4_ACTTTATTGTGATTATTTGA
BKK19900 ([gene|177BAE8E5143CBE479B8EF6814F2A1066E72D658|yotF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAATCCCTCCTTGTAC,  downstream forward: _UP4_ACTTTATTGTGATTATTTGA
References
25299644,9387222

177BAE8E5143CBE479B8EF6814F2A1066E72D658

Page visits: 1323

Time of last update: 2022-12-01 00:19:52

Author of last update: Bzhu