ydfB

ydfB
168

similar to GCN5-related N-acetyltransferase

locus
BSU_05350
Molecular weight
29.53 kDa
pI
5.7
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydfB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
581,694  582,479
The protein
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 135-261) (according to UniProt)
Structure
[PDB|3G3S] (from Streptococcus suis, 27% identity)
[AF|P96679]
Expression and Regulation
Operons
genes
[gene|17921229BA265111A7D0CD95BA02A7A495CCA33D|ydfB]
description
[pubmed|22383849]
Open in new tab

[gene|17921229BA265111A7D0CD95BA02A7A495CCA33D|ydfB]

2022-11-25 16:04:02

Jstuelk

16

8ff1e3253b7e497a042e58b74b5225ec9cb4a0e3

F883449841E42330CB9AFF73768B81F7FAE8D600

Biological materials
Mutant
MGNA-C142 (ydfB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2140 NBRP B. subtilis, Japan]
BKE05350 ([gene|17921229BA265111A7D0CD95BA02A7A495CCA33D|ydfB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTCCTTTAAAACACCGT,  downstream forward: _UP4_TAACCTTAATGAAAGAACCT
BKK05350 ([gene|17921229BA265111A7D0CD95BA02A7A495CCA33D|ydfB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTCCTTTAAAACACCGT,  downstream forward: _UP4_TAACCTTAATGAAAGAACCT
References
27766092

17921229BA265111A7D0CD95BA02A7A495CCA33D

Page visits: 830

Time of last update: 2022-12-01 03:31:10

Author of last update: Melvin.boenninger