yacL

yacL
168

general stress protein, survival of salt and ethanol stresses

locus
BSU_00890
Molecular weight
40.70 kDa
pI
4.97
Protein length
Gene length
function
survival of salt and ethanol stresses
product
unknown
essential
no
ec
null
synonyms
yacL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4956

This gene is a member of the following regulons

Gene
Coordinates
108,674  109,774
The protein
Protein family
Ycf81 family (single member, according to UniProt)
[wiki|Domains]
PINc domain (aa 169-280) ( according to UniProt)
[wiki|TRAM domain] (aa 295-356) (according to UniProt)
Structure
[PDB|3IX7] (from Thermus thermophilus, corresponds to aa 168 ... 294, 45% identity)
[AF|Q06754]
Expression and Regulation
Operons
genes
[gene|179FDEA51A060DF32A3EA06A796793DE27B600FF|yacL]-[gene|CF9633F769263C6D16EE778F6BD2ECF1995F512A|ispD]-[gene|1A6793A3A5AC568C67873C8708E9F581F42AB9BA|ispF]
description
[Pubmed|10482513]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|17434969], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
Open in new tab

[gene|179FDEA51A060DF32A3EA06A796793DE27B600FF|yacL]→[gene|1A6793A3A5AC568C67873C8708E9F581F42AB9BA|ispF]

2022-11-24 18:53:40

ghost

30

7dc686870ed58f71ca9e5b0841c69a922f74d84a

EFDC5F8C8F63B342C29A9AB39CD8005147D16917

Biological materials
Mutant
MGNA-B933 (yacL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1932 NBRP B. subtilis, Japan]
BKE00890 ([gene|179FDEA51A060DF32A3EA06A796793DE27B600FF|yacL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCCCCACCTCCTTTTT,  downstream forward: _UP4_GCGCTGTAAAGGGAGAAGAA
BKK00890 ([gene|179FDEA51A060DF32A3EA06A796793DE27B600FF|yacL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCCCCACCTCCTTTTT,  downstream forward: _UP4_GCGCTGTAAAGGGAGAAGAA
References
15805528,10482513,17434969

179FDEA51A060DF32A3EA06A796793DE27B600FF

Page visits: 1582

Time of last update: 2022-12-06 00:24:42

Author of last update: Melvin.boenninger