SubtiWiki SubtiWiki
acuA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

acuA
168

protein acetylase for the control of [protein|search|AcsA ]activity

locus
BSU_29690
Molecular weight
24.18 kDa
pI
5.03
Protein length
Gene length
function
control of [protein|search|AcsA ]activity
product
Gcn5-related N-acetyltransferase
essential
no
synonyms
acuA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,040,092  3,040,724
The protein
Catalyzed reaction/ biological activity
acetylates (and thereby inactivates) [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA] on Lys-549  [Pubmed|18487328] [Pubmed|19136592]
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
Gcn5-relatedN-acetyltransferase  [Pubmed|18487328]
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 20-161) (according to UniProt)
Structure
[PDB|2Q04] (from Exiguobacterium sibiricum, 59% identity)
Expression and Regulation
Operons
genes
[gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]-[gene|FC9981CFB9D7EB8ACDA3032EC2F0538988F277AA|acuB]-[gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]
description
[Pubmed|7934817]
regulation
repressed by glucose (3.4-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|7913927,12850135]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|7913927], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7913927], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the mRNA is quite stable (half-life 5 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]→[gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]

2021-09-20 16:16:37

Jstuelk

7

0c83d2dce6fb2fd652b90f3db87e253e0dd5a2cb

C4FEF5C006237E0BF05F8B8DB65202D8D51016FB

Biological materials
Mutant
GP1211 (''acuA''::''kan''), available in [wiki|Jörg Stülke]'s lab
GP1255 (''[gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]''::''kan'' ''[gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]''::''cat'' ''[gene|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]''::''spec'' ''[gene|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|yoaA]''::''tet''), available in [wiki|Jörg Stülke]'s lab
BKE29690 ([gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTAATTCACCGTCCCATC,  downstream forward: _UP4_TAACTGACACTGACAAAGGG
BKK29690 ([gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTAATTCACCGTCCCATC,  downstream forward: _UP4_TAACTGACACTGACAAAGGG
References
7913927,22900538,16855235,7934817,19136592,18487328,12850135,26098117,29093482,12884008,30265683

17C3F56CE859BCD7A282C144C46CC92D3506ABF6

Page visits: 2448

Time of last update: 2021-09-22 11:29:09

Author of last update: Melvin.boenninger