SubtiWiki SubtiWiki
nhaK

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

nhaK
168

cation/H+ antiporter

locus
BSU_33420
Molecular weight
75.05 kDa
pI
9.22
Protein length
Gene length
function
monovalent cation export
product
cation/H+ antiporter
essential
no
synonyms
nhaK, yvgP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0025

This gene is a member of the following regulons

Gene
Coordinates
3,428,331  3,430,343
Phenotypes of a mutant
specific gain-of-function point mutations affecting [protein|17F0D94ED61E0AF1015FBC845BC2B5B670311C6F|nhaK] facilitate the adaptation a strain lacking c-di-AMP to growth on medium containing potassium or glutamate, these mutations enhance the activity of [protein|17F0D94ED61E0AF1015FBC845BC2B5B670311C6F|nhaK] in potassium export [pubmed|28420751,33481774]
The protein
Catalyzed reaction/ biological activity
export of Na+, K+, Li+, Rb+
Protein family
monovalent cation:proton antiporter 1 (CPA1) transporter (TC 2.A.36) family (single member, according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|17F0D94ED61E0AF1015FBC845BC2B5B670311C6F|nhaK]
description
[Pubmed|16021482]
regulation
constitutive, expression increases in the presence of Na+ and K+ [Pubmed|16021482]
Open in new tab

[gene|17F0D94ED61E0AF1015FBC845BC2B5B670311C6F|nhaK]

2022-01-13 12:46:32

Jstuelk

4

fd9f529f4ce3208805eb406fb99847b87146a5f3

9C62C26CD4859D9C5CD4CB478377450237DA851B

Biological materials
Mutant
MGNA-A455 (yvgP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/455 NBRP B. subtilis, Japan]
GP2226 (''[gene|17F0D94ED61E0AF1015FBC845BC2B5B670311C6F|nhaK]''::''aphA3''), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
BKE33420 ([gene|17F0D94ED61E0AF1015FBC845BC2B5B670311C6F|nhaK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATGCATGACCTCCTTCG,  downstream forward: _UP4_TAAATGCAGAAAAAAAGCTG
BKK33420 ([gene|17F0D94ED61E0AF1015FBC845BC2B5B670311C6F|nhaK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATGCATGACCTCCTTCG,  downstream forward: _UP4_TAAATGCAGAAAAAAAGCTG
FLAG-tag construct
GP2436 ''nhaK-3xFLAG spc'' (based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
27935846
Original Publications
16021482,28420751,33481774

17F0D94ED61E0AF1015FBC845BC2B5B670311C6F

Page visits: 1554

Time of last update: 2022-01-18 18:31:18

Author of last update: Jstuelk