yrdK

yrdK
168

unknown

locus
BSU_26680
Molecular weight
12.18 kDa
pI
8.85
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yrdK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,726,885  2,727,163
The protein
Structure
[AF|P94500]
Expression and Regulation
Operons
genes
[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]-[gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]-[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]
description
[Pubmed|36377869,9287000]
regulation
repressed by [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB] [Pubmed|36377869,9287000]
regulatory mechanism
[protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]: repression, [Pubmed|36377869,9287000], in [regulon|protein:D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB regulon]
Open in new tab

[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]→[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]

2022-12-01 22:01:55

Jstuelk

29

CE7A54721725B20F53C4F64C9153F7B05416307A

77D75B92D3B22CF1350DD9E108E868095EE55DEB

Biological materials
Mutant
MGNA-A863 (yrdK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/863 NBRP B. subtilis, Japan]
BKE26680 ([gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATCAACTTGTTTTTGTTCG,  downstream forward: _UP4_TAGGTTTCACGATTCAGAGT
BKK26680 ([gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATCAACTTGTTTTTGTTCG,  downstream forward: _UP4_TAGGTTTCACGATTCAGAGT
References
9287000

17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6

Page visits: 1075

Time of last update: 2022-12-06 02:02:38

Author of last update: Bzhu