copZ

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

copZ
168

copper transport protein, metallochaperone

locus
BSU_33510
Molecular weight
7.20 kDa
pI
4.16
Protein length
Gene length
function
resistance to copper
product
copper transport protein, metallochaperone
essential
no
synonyms
copZ, yvgY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2608

This gene is a member of the following regulons

Gene
Coordinates
3,443,613  3,443,822
The protein
Catalyzed reaction/ biological activity
transfers Cu(I) to [protein|727024F7B1AC19676ED4B516CF46A47B1328310B|copA] [Pubmed|28078344]
[wiki|Domains]
HMA domain (aa 3-69) (according to UniProt)
[wiki|Cofactors]
carries a tetranuclear Cu(I) cluster (as [Cu4(S-Cys)4(N-His)2] cluster) [Pubmed|19746989]
Structure
[PDB|2QIF]
[AF|O32221]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|6977F18870004AD236539D9409255815E6BE9241|csoR]-[gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
description
[Pubmed|22383849]
Open in new tab

[gene|6977F18870004AD236539D9409255815E6BE9241|csoR]→[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]

2022-01-25 04:38:05

Jstuelk

13

eb86b49e4fa20367c75145f1a228f37db4b5da04

AAFF284B2BD1673523D4C48EA1D3231D7A156AFC

genes
[gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
description
[Pubmed|12779235]
regulation
induced by copper ([protein|search|CsoR]) [Pubmed|18048925,12779235]
regulatory mechanism
[protein|6977F18870004AD236539D9409255815E6BE9241|csoR]: repression, [Pubmed|18048925], in [regulon|protein:6977F18870004AD236539D9409255815E6BE9241|csoR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12779235], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]→[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]

2022-03-03 13:24:40

ghost

18

82e064a450e42e8934b8717c092adbe5ec47123b

C1EEB785789E5FED12C2A62EF4EB3404C7EFF35B

Biological materials
Mutant
BKE33510 ([gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCAATTCCTCCTGTTT,  downstream forward: _UP4_TGATTCAAGGTATCGCGCCT
BKK33510 ([gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCAATTCCTCCTGTTT,  downstream forward: _UP4_TGATTCAAGGTATCGCGCCT
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
References
Reviews
19824702,10742187
Original Publications
18361527,11922674,12590580,14663075,12779235,12644235,18048925,19170606,14514665,14711369,15212800,19170606,19746989,19751213,18419582,22370900,12238948,11980486,27197762,28078344

18506FB74F6BB9278F22EB7DCDA3CF72575CC32A

Page visits: 2177

Time of last update: 2022-05-17 17:58:54

Author of last update: Melvin.boenninger