SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


copper transport protein, metallochaperone

Molecular weight
7.20 kDa
Protein length
Gene length
resistance to copper
copper transport protein, metallochaperone
copZ, yvgY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2608

This gene is a member of the following regulons

3,443,613  3,443,822
The protein
Catalyzed reaction/ biological activity
transfers Cu(I) to [protein|727024F7B1AC19676ED4B516CF46A47B1328310B|copA] [Pubmed|28078344]
HMA domain (aa 3-69) (according to UniProt)
carries a tetranuclear Cu(I) cluster (as [Cu4(S-Cys)4(N-His)2] cluster) [Pubmed|19746989]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Open in new tab


2021-12-28 15:37:04





induced by copper ([protein|search|CsoR]) [Pubmed|18048925,12779235]
regulatory mechanism
[protein|6977F18870004AD236539D9409255815E6BE9241|csoR]: repression, [Pubmed|18048925], in [regulon|protein:6977F18870004AD236539D9409255815E6BE9241|csoR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12779235], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-01-14 20:23:03





Biological materials
BKE33510 ([gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCAATTCCTCCTGTTT,  downstream forward: _UP4_TGATTCAAGGTATCGCGCCT
BKK33510 ([gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCAATTCCTCCTGTTT,  downstream forward: _UP4_TGATTCAAGGTATCGCGCCT
[wiki|John Helmann], Cornell University, USA [ Homepage]
Original Publications


Page visits: 2024

Time of last update: 2022-01-19 09:29:26

Author of last update: Melvin.boenninger