yxnA

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yxnA
168

general stress protein, similar to ketoacyl reductase, survival of ethanol stress

locus
BSU_40000
Molecular weight
39.20 kDa
pI
9.31
Protein length
Gene length
function
survival of ethanol stress
product
unknown
essential
no
synonyms
yxnA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0300

This gene is a member of the following regulons

Gene
Coordinates
4,108,058  4,109,128
The protein
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|4NBU] ([protein|439B468A13137000FB42E9389391CB4986FFED84|fabG] from Bacillus sp., corresponds to aa 26 ... 255 of YxnA, 32% identity) [pubmed|24212572]
[AF|O32291]
Paralogous protein(s)
[protein|0927C7D45721F47F5ED2646CAAC324A308FD7724|yqjQ], (32,1%)
Expression and Regulation
Operons
genes
[gene|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA]
description
[Pubmed|10746760]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA]

2022-04-13 14:21:14

ghost

7

ea6ef8cbab3dbcf27026163581b2a55c1e898b2e

7BA9D94C962620311B7B6F5CFE18674CFAB9B66C

Biological materials
Mutant
MGNA-B762 (yxnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1761 NBRP B. subtilis, Japan]
BKE40000 ([gene|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAGAGATCCCTCCTAG,  downstream forward: _UP4_TAATCTCTGACCATAAGAAA
BKK40000 ([gene|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAGAGATCCCTCCTAG,  downstream forward: _UP4_TAATCTCTGACCATAAGAAA
References
15805528,10746760,24212572

18698DA427051097DEEE63F45F3429B8617B1F48

Page visits: 869

Time of last update: 2022-05-16 13:47:02

Author of last update: Jstuelk