SubtiWiki SubtiWiki
yxnA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yxnA
168

general stress protein, similar to ketoacyl reductase, survival of ethanol stress

locus
BSU_40000
Molecular weight
39.20 kDa
pI
9.31
Protein length
Gene length
function
survival of ethanol stress
product
unknown
essential
no
synonyms
yxnA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0300

This gene is a member of the following regulons

Gene
Coordinates
4,108,058  4,109,128
The protein
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|4NBU] ([protein|439B468A13137000FB42E9389391CB4986FFED84|fabG] from Bacillus sp., corresponds to aa 26 ... 255 of YxnA, 32% identity) [pubmed|24212572]
Paralogous protein(s)
[protein|0927C7D45721F47F5ED2646CAAC324A308FD7724|yqjQ], (32,1%)
Expression and Regulation
Operons
genes
[gene|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA]
description
[Pubmed|10746760]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA]

2021-09-25 18:21:03

ghost

3

ea6ef8cbab3dbcf27026163581b2a55c1e898b2e

7BA9D94C962620311B7B6F5CFE18674CFAB9B66C

Biological materials
Mutant
MGNA-B762 (yxnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1761 NBRP B. subtilis, Japan]
BKE40000 ([gene|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAGAGATCCCTCCTAG,  downstream forward: _UP4_TAATCTCTGACCATAAGAAA
BKK40000 ([gene|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAGAGATCCCTCCTAG,  downstream forward: _UP4_TAATCTCTGACCATAAGAAA
References
15805528,10746760,24212572

18698DA427051097DEEE63F45F3429B8617B1F48

Page visits: 809

Time of last update: 2022-01-13 20:27:07

Author of last update: Jstuelk