yckA

yckA
168

similar to amino acid [wiki|ABC transporter] (permease)

locus
BSU_03370
Molecular weight
25.08 kDa
pI
9.43
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yckA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0765

This gene is a member of the following regulons

Gene
Coordinates
367,305  367,985
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 27-215) (according to UniProt)
Structure
[PDB|4YMS] (amino acid transporter from Caldanaerobacter subterraneus, 35% identity) [pubmed|25848002]
[AF|P42399]
Paralogous protein(s)
[protein|9400DF25487461E3738DDDC72BDDB1589281409D|tcyB], [protein|FFD5F07480A0E5A74852C69C436EE289BA72FC7F|yxeN]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]-[gene|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|yckA]
description
[Pubmed|22383849]
Open in new tab

[gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]→[gene|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|yckA]

2022-11-21 20:13:32

Jstuelk

32

cd5a57519adc46d46da39741069f94c69b925750

C74A617AE5313DE93EED08FE6C32E099016B6B6E

Biological materials
Mutant
MGNA-C001 (yckA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1999 NBRP B. subtilis, Japan]
BKE03370 ([gene|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|yckA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATGCTATTGATCATGGCGT,  downstream forward: _UP4_TAAACAAACGTTTCATTAAA
BKK03370 ([gene|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|yckA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATGCTATTGATCATGGCGT,  downstream forward: _UP4_TAAACAAACGTTTCATTAAA
References
10092453,25848002

1872614A6F7DBF7231348AC3DAE4ED3295ACEB41

Page visits: 1385

Time of last update: 2022-11-29 01:49:51

Author of last update: Melvin.boenninger