ynaD

ynaD
168

similar to ribosomal-protein-alanine N-acetyltransferase

locus
BSU_17520
Molecular weight
20.22 kDa
pI
5.34
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ynaD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1670

This gene is a member of the following regulons

Gene
Coordinates
1,883,166  1,883,678
The protein
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 8-167) (according to UniProt)
Structure
[PDB|3FBU] (from B. anthracis, 82% identity)
[AF|P94482]
Paralogous protein(s)
[protein|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|yoaA]
[protein|F92B7EC7A00BF295666D68613932D239F92C7347|ykkB], (31,7%)
Biological materials
Mutant
MGNA-B382 (ynaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1381 NBRP B. subtilis, Japan]
GP1247 (''ynaD''::''spec''), available in [wiki|Jörg Stülke]'s lab
GP1255 (''[gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]''::''kan'' ''[gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]''::''cat'' ''[gene|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]''::''spec'' ''[gene|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|yoaA]''::''tet''), available in [wiki|Jörg Stülke]'s lab
BKE17520 ([gene|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAGCAACTCCCCTCT,  downstream forward: _UP4_TGAACTTTATTGAGTGCGGC
BKK17520 ([gene|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAGCAACTCCCCTCT,  downstream forward: _UP4_TGAACTTTATTGAGTGCGGC

18FA5EFCD78C74296F9E52A64DA4A9D635944528

Page visits: 1123

Time of last update: 2022-11-28 22:28:26

Author of last update: Jstuelk