gerE

gerE
168

transcriptional regulator (repressor or activator) of a subset of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]-dependent late spore coat genes

locus
BSU_28410
Molecular weight
8.43 kDa
pI
9.64
Protein length
Gene length
function
regulation of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]-dependent gene expression
product
transcriptional regulator (LuxR-FixJ family)
essential
no
synonyms
gerE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5905

This gene is a member of the following regulons

Gene
Coordinates
2,904,727  2,904,951
Phenotypes of a mutant
unable to germinate efficiently [Pubmed|3139490]
The protein
Protein family
LuxR-FixJ family of transcription regulators
[wiki|Domains]
[wiki|HTH luxR-type domain] (aa 5-70) (according to UniProt)
Structure
[PDB|1FSE]
[AF|P11470]
Expression and Regulation
Operons
genes
[gene|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]
description
[Pubmed|3114423]
regulation
expressed late during sporulation in the mother cell ([protein|search|SigK], [wiki|SpoIIID]) [Pubmed|15699190,7896717]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: activation, [Pubmed|7896717], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
[protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]: mRNA stability control, results in mRNA accumulation [Pubmed|16923907], in [regulon|protein:E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]

2022-12-29 17:55:58

ghost

34

255385a10f99947e6395d7a7a0ac1f029f4a8227

33B781DA9AE74BE2AE58112DEE93AFC4A633F526

Biological materials
Mutant
BKE28410 ([gene|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGTATTGTAACCCTCCTT,  downstream forward: _UP4_TAATCCTTGCCGGTATTCCT
BKK28410 ([gene|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGTATTGTAACCCTCCTT,  downstream forward: _UP4_TAATCCTTGCCGGTATTCCT
labs
[wiki|Arthur Aronson], Purdue University, West Lafayette, USA [http://wwwdev.gradschool.purdue.edu/PULSe/faculty.cfm?fid=5&range=0 homepage]
[wiki|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
References
Reviews
31350897,35638784
Original Publications
7519271,2474075,11418558,10400595,7592393,11741866,7592342,3135411,9852018,1691789,15383836,11150673,1518043,7814326,14523132,12031481,11418558,3114423,7896717,11243786,17890309,15470121,20435725,21670523,23064347,3139490,25259857,6787012,26279233,16923907

19228BAD44E6DA3DE908DC390FDF628C18D94E65

Page visits: 4719

Time of last update: 2023-02-07 12:21:48

Author of last update: Jstuelk