ysdA

ysdA
168

unknown

locus
BSU_28840
Molecular weight
10.18 kDa
pI
9.96
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ysdA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3326

This gene is a member of the following regulons

Gene
Coordinates
2,951,898  2,952,167
The protein
Structure
[AF|P94519]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]
description
[Pubmed|17289755]
regulation
[protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
[protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]: termination, via binding to a [wiki|RNA switch] in the [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC] leader region causes transcription termination, in [regulon|protein:803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT regulon]
additional information
autorepression of [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA] expression upon binding of excess [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT] to the untranslated region of the mRNA [Pubmed|29925569,17616982]
expression of [protein|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|IF3 ]is uncoupled from that of [protein|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|L35 ]and [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|L20 ]by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent mRNA processing [PubMed|21843271]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
Open in new tab

[gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]→[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]

2022-11-18 18:37:24

Jstuelk

43

6ec080dce630885303f3f439404a1624accce660

33D5901765B267FCB4C316CA6BBC47536C5ACFC6

Biological materials
Mutant
GP2391 ∆''[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]''::''kan'', available in [wiki|Jörg Stülke]'s lab
MGNA-B024 (ysdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1023 NBRP B. subtilis, Japan]
BKE28840 ([gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCCTCATCCTTTAT,  downstream forward: _UP4_GATTTATAAAAAGCAGAAAA
BKK28840 ([gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCCTCATCCTTTAT,  downstream forward: _UP4_GATTTATAAAAAGCAGAAAA
References
17289755,29925569

19349FDFE0F9A46FCCAA684B8139E592979DB317

Page visits: 1117

Time of last update: 2022-11-29 12:40:20

Author of last update: Aklewing