ycbG

ycbG
168

transcription regulator of the glucarate/galactarate utilization operon ([wiki|GntR family])

locus
BSU_02500
Molecular weight
26.43 kDa
pI
5.99
Protein length
Gene length
function
regulation of glucarate/galactarate utilization
product
transcription regulator ([wiki|GntR family])
essential
no
synonyms
ycbG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2186

This gene is a member of the following regulons

Gene
Coordinates
273,237  273,938
The protein
Protein family
[wiki|GntR family] of transcription factors
[wiki|Domains]
[wiki|HTH gntR-type domain] (aa 16–84) (according to UniProt)
Structure
[PDB|2DI3] (from Corynebacterium glutamicum, corresponds to aa 20 ... 178, 32.7% identity) [pubmed|18988622]
[AF|P42239]
Expression and Regulation
Operons
genes
[gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]-[gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]-[gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]-[gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]-[gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]-[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]-[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]
description
[Pubmed|12044674]
regulation
induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
regulatory mechanism
[protein|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]: repression, [Pubmed|12044674], in [regulon|protein:1A65880F68898002EE8774F34EDC47F0243B7273|ycbG regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]→[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]

2022-12-06 18:16:03

ghost

39

a8e395a36da4d417bafa3e16f332fbbf2dcf2e61

24EBFC92FB6A93BD115AC81FF68694FB539EE76E

Biological materials
Mutant
MGNA-C030 (ycbG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2028 NBRP B. subtilis, Japan]
BKE02500 ([gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGAACAACTCTCCCTTCA,  downstream forward: _UP4_TAATGGTGAGCAACCGCAGT
BKK02500 ([gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGAACAACTCTCCCTTCA,  downstream forward: _UP4_TAATGGTGAGCAACCGCAGT
References
12044674,23504016,18988622

1A65880F68898002EE8774F34EDC47F0243B7273

Page visits: 1542

Time of last update: 2022-12-07 16:27:54

Author of last update: Jstuelk