sunA

sunA
168

sublancin 168 is post-translationally modified antimicrobial precursor peptide from the glycocin class

locus
BSU_21480
Molecular weight
5.85 kDa
pI
7.96
Protein length
Gene length
function
exported antimicrobial peptide
product
sublancin 168 antimicrobial precursor peptide
essential
no
synonyms
sunA, yolG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,269,521  2,269,691
The protein
Structure
[PDB|2MIJ] [Pubmed|24405370]
[AF|P68577]
Modification
contains a glucose attached to a cysteine residue, glycosylation is essential for its antimicrobial activity [Pubmed|21196935]
[wiki|Localization]
secreted [pubmed|21196935]
Expression and Regulation
Operons
genes
[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|260693EE7F5B5CE2A141149D292405E84B7A5FF4|sunT]-[gene|DB5F719C0A2F610301E174F6890DA9E826C76932|bdbA]-[gene|6B2DC9873B7B693D9D0FC0D773740140D0640C9E|sunS]-[gene|12CE5AE0BD02C989E803480A1CE5A47D6192D751|bdbB]
description
[Pubmed|22383849]
regulation
repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]-[wiki|DnaA] [Pubmed|27902860,15743949]
expression starts in the stationary phase [pubmed|30808982]
expression is heterogeneous in the population, this is mediated by [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok], and [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A] [pubmed|30808982]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]: activation, [Pubmed|20817675,19465659], in [regulon|protein:5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh regulon]
[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA] [Pubmed|27902860,15743949], in [regulon|protein:6740108089F13116F200C15F35C2E7561E990FEB|dnaA regulon]
[protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]: activation, [Pubmed|16306698], in [regulon|protein:7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
the mRNA is very stable (> 15 min) [pubmed|12884008]
the amount of the mRNA is substantially decreased upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]→[gene|12CE5AE0BD02C989E803480A1CE5A47D6192D751|bdbB]

2022-11-26 01:28:20

Jstuelk

46

173a6d1c6c62ab55ab2900d516e97b549076ae97

85D1B8FA2F46C6C22D4D5CAD32F0080E33BACFA0

genes
[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]
description
[Pubmed|16306698]
regulation
repressed by [protein|search|Rok]-[wiki|DnaA] [Pubmed|27902860,15743949]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]

2022-12-02 06:40:28

ghost

34

10bd5592c0dbc9f329d41c63d60f1e62f2320dc9

E429B2295B8ABFBACF3C2E7FD2F3A77D5E689B93

Biological materials
Mutant
GP1563 (aphA3), available in [wiki|Jörg Stülke]'s labb
GP1565 ([gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI], aphA3), available in [wiki|Jörg Stülke]'s lab
BKE21480 ([gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTAAAACCTCCCCAT,  downstream forward: _UP4_TAAAACATTTGTAGAGGGAA
BKK21480 ([gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTAAAACCTCCCCAT,  downstream forward: _UP4_TAAAACATTTGTAGAGGGAA
References
30582697,27902860,12884008,9722542,15743949,17720793,16306698,19465659,21196935,24405370,22400495,20817675,21910430,25879813,26282429,26339632,29112373,30808982,34186025

1A6D90298D039FFFD977B2534952BA5E32B3530F

Page visits: 5078

Time of last update: 2022-12-06 03:34:28

Author of last update: Jstuelk