yceJ

yceJ
168

similar to multidrug-efflux transporter

locus
BSU_02960
Molecular weight
41.80 kDa
pI
9.91
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yceJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
319,180  320,352
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[AF|O34724]
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-C048 (yceJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2046 NBRP B. subtilis, Japan]
BKE02960 ([gene|1AAC42E6E96DC358E79C75DB2BBB3E40353E1890|yceJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTTTATCACTCCTATT,  downstream forward: _UP4_TAAAAAAGCACCTCATTCAA
BKK02960 ([gene|1AAC42E6E96DC358E79C75DB2BBB3E40353E1890|yceJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTTTATCACTCCTATT,  downstream forward: _UP4_TAAAAAAGCACCTCATTCAA
References
27766092

1AAC42E6E96DC358E79C75DB2BBB3E40353E1890

Page visits: 1137

Time of last update: 2022-12-06 03:18:12

Author of last update: Melvin.boenninger