gbsA

gbsA
168

glycine betaine-aldehyde dehydrogenase, glycine betaine synthesis

locus
BSU_31060
Molecular weight
53.50 kDa
pI
4.71
Protein length
Gene length
function
osmoprotection
product
glycine betaine-aldehyde dehydrogenase
essential
no
ec
1.2.1.8
synonyms
gbsA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

Gene
Coordinates
3,185,092  3,186,564
The protein
Catalyzed reaction/ biological activity
betaine aldehyde + H2O + NAD+ --> betaine + 2 H+ + NADH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
Structure
[PDB|4QTO] (from ''Staphylococcus aureus'', 67% identity, 87% similarity)
[AF|P71016]
Paralogous protein(s)
[protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]
Expression and Regulation
Operons
genes
[gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]-[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]
description
[Pubmed|8752328]
regulation
induced by choline ([protein|search|GbsR]) [Pubmed|22408163,8752328]
regulatory mechanism
[protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]: repression, (transcriptional roadblock) [Pubmed|32849357,22408163], in [regulon|protein:5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8752328], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]→[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]

2022-12-02 11:14:48

ghost

19

937063a9a54ed4e12875306102d73517e6ee5839

8CD6FD61ACBEF014C97BE839B61E435F9EC8941B

Biological materials
Mutant
1A1056 ( ''gbsA''::''kan''), [Pubmed|21296969], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1056&Search=1A1056 BGSC]
BKE31060 ([gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAAGCCTCCTTGACGT,  downstream forward: _UP4_AATTCATAAGAGGGGGAGAT
BKK31060 ([gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAAGCCTCCTTGACGT,  downstream forward: _UP4_AATTCATAAGAGGGGGAGAT
labs
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
References
9297465,8752328,21296969,22408163,29159878,32849357

1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E

Page visits: 2380

Time of last update: 2022-12-01 09:32:41

Author of last update: Jstuelk