ydfJ

ydfJ
168

phospholipid efflux pump

locus
BSU_05430
Molecular weight
76.85 kDa
pI
5.18
Protein length
Gene length
function
resistance to the membrane-acting antibiotic rhodomyrtone
product
phospholipid efflux pump
essential
no
ec
null
synonyms
ydfJ, farE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2409

This gene is a member of the following regulons

Gene
Coordinates
589,717  591,891
The protein
Catalyzed reaction/ biological activity
export of phosphatidylglycerol-containing phospholipids
Protein family
resistance-nodulation-cell division (RND) (TC 2.A.6) family (with [protein|1632474628BEA113F297897D152276A1AB73BAE8|ydgH] and [protein|AAC32230E3E585932A876737131C3E2C15168B2A|swrC], according to UniProt)
Structure
[PDB|6N3T] (from Mycobacterium smegmatis, 25% identity) [pubmed|31113875]
[AF|P96687]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ]
description
[pubmed|22383849]
regulatory mechanism
[protein|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]: activation, [Pubmed|15941986], in [regulon|protein:EFEAF09E4449A022A7323450FDED9458426A0080|ydfI regulon]
Open in new tab

[gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ]

2022-11-20 08:00:55

Bzhu

32

2cea5a528ebfad66858873afe3c125b8e7224187

6E4183E9DEE8CBE933A81F3157F955AE93DB05E8

Biological materials
Mutant
MGNA-C149 (ydfJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2147 NBRP B. subtilis, Japan]
BKE05430 ([gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATAATCTCCTTTCAAC,  downstream forward: _UP4_TAATAGAAAAAGCAGATCTT
BKK05430 ([gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATAATCTCCTTTCAAC,  downstream forward: _UP4_TAATAGAAAAAGCAGATCTT
References
15941986,31113875

1B61298ECA583D2112AA56A88358E8A9A55D2C9D

Page visits: 1705

Time of last update: 2022-11-27 07:10:54

Author of last update: Jstuelk