dltB

dltB
168

D-alanine transfer from [protein|862D977CF1E185597329A1EF0915485F72482A03|dltC] to undecaprenol-phosphate, alanylation of teichoic acid provides some resistance against positively charged antimicrobial peptides

locus
BSU_38510
Molecular weight
46.58 kDa
pI
9.94
Protein length
Gene length
function
biosynthesis of teichoic acid
product
D-alanine transfer from [protein|862D977CF1E185597329A1EF0915485F72482A03|dltC] to undecaprenol-phosphate
essential
no
synonyms
dltB, ipa-4r

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1696

This gene is a member of the following regulons

Gene
Coordinates
3,953,783  3,954,970
Phenotypes of a mutant
more sensitive to nisin [Pubmed|23980836]
The protein
Protein family
Membrane-bound acyltransferase family (single member, according to UniProt)
Structure
[PDB|6BUI] (from Streptococcus thermophilus) [pubmed|30283133]
[PDB|6BUG] ([protein|search|DtlB]-[protein|862D977CF1E185597329A1EF0915485F72482A03|dltC] complex from Streptococcus thermophilus) [pubmed|30283133]
[PDB|6BUH] ([protein|search|DtlB]-[protein|862D977CF1E185597329A1EF0915485F72482A03|dltC] complex from Streptococcus thermophilus) [pubmed|30283133]
[AF|P39580]
[wiki|Localization]
cytoplasma membrane [Pubmed|30283133]
Expression and Regulation
Operons
genes
[gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH]-[gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA]-[gene|1B9BAEBE029BE9D4AD7E49C38B1E6DB5E8F4D4D3|dltB]-[gene|862D977CF1E185597329A1EF0915485F72482A03|dltC]-[gene|D178EC8A1FF22C99C437E01FC4843C5176564992|dltD]-[gene|2FB3F09DA60A40212FE20217A64DAE714AB807CF|dltE]
description
[Pubmed|29794222]
regulation
expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV] mutant [Pubmed|21926231]
the mRNA is processed between [gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH] and [gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
regulatory mechanism
[protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]: activation, [Pubmed|16306698], in [regulon|protein:7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb regulon]
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|7797557], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|7797557], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|14762009], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
[protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]: sigma factor, [Pubmed|21926231], in [regulon|protein:D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV regulon]
Open in new tab

[gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH]→[gene|2FB3F09DA60A40212FE20217A64DAE714AB807CF|dltE]

2022-11-29 16:15:14

Jstuelk

46

63d2b4db0f70a01e2ae028dbd1af243776b4151a

0645FBFBF0B41CCF60F55D60BCBA00E9E016D681

Biological materials
Mutant
BKE38510 ([gene|1B9BAEBE029BE9D4AD7E49C38B1E6DB5E8F4D4D3|dltB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGTCATACAAGAACCTCTTC,  downstream forward: _UP4_CACCATTAAAGGAGATTAGA
BKK38510 ([gene|1B9BAEBE029BE9D4AD7E49C38B1E6DB5E8F4D4D3|dltB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGTCATACAAGAACCTCTTC,  downstream forward: _UP4_CACCATTAAAGGAGATTAGA
References
Reviews
24819367
Original Publications
14762009,12028417,7797557,18763711,23980836,21856855,21926231,30283133

1B9BAEBE029BE9D4AD7E49C38B1E6DB5E8F4D4D3

Page visits: 2593

Time of last update: 2022-11-29 11:53:46

Author of last update: Jstuelk