sfp/1

sfp/1
168

4-phosphopantetheinyl transferase (surfactin synthetase-activating enzyme), required for production of surfactin, plipastatin and bacillaene, inactive pseudogene in strain 168

locus
BSU_03569
Protein length
Gene length
function
phosphopantetheinylates a serine residue in each of the seven peptidyl carrier protein domains of the first three subunits of surfactin synthetase (SrfAA-SrfAB-SrfAC) and AcpK
product
4-phosphopantetheinyl transferase
essential
no
ec
null
synonyms
sfp/1, sfp

Genomic Context

Categories containing this gene/protein

This gene is a member of the following regulons

Gene
Coordinates
407,460  407,627
Phenotypes of a mutant
No swarming motility on B medium. [Pubmed|19202088]
The protein
Catalyzed reaction/ biological activity
CoA + apo-[peptidyl-carrier protein] = adenosine 3',5'-bisphosphate + holo-[peptidyl-carrier protein] (according to Swiss-Prot)
Protein family
Gsp/sfp/hetI/acpT family (according to Swiss-Prot)
Biological materials
Mutant
BKE03569 ([gene|1C4F076D54F5A07AC351D722A403F249ED097555|sfp/1]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03569 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGGTGCAGGCGCACTGAAA,  downstream forward: _UP4_ACAATGGTCTCGTACGAAGA
BKK03569 ([gene|1C4F076D54F5A07AC351D722A403F249ED097555|sfp/1]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03569 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGGTGCAGGCGCACTGAAA,  downstream forward: _UP4_ACAATGGTCTCGTACGAAGA
labs
[wiki|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
References
Reviews
20735481
Original Publications
15955059,19202088,2848009,11489886,15065855,10581256,15066026,11867633,19202088,19749039,20094656,9484229,20148996,21278284,21466506,22773650,24826903,25002419

1C4F076D54F5A07AC351D722A403F249ED097555

Page visits: 2943

Time of last update: 2022-12-01 06:50:18

Author of last update: Bzhu