gntR

gntR
168

transcriptional repressor (GntR family) of the gntR-gntK-gntP-gntZ operon

locus
BSU_40050
Molecular weight
28.13 kDa
pI
5.26
Protein length
Gene length
function
regulation of gluconate utilization
product
transcriptional repressor of the gluconate operon
essential
no
synonyms
gntR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1802

This gene is a member of the following regulons

Gene
Coordinates
4,113,417  4,114,148
The protein
Protein family
[wiki|GntR family] of transcription factors
[wiki|Domains]
[wiki|HTH gntR-type domain] (aa 17-83) (according to UniProt)
Structure
[AF|P10585]
Effectors of protein activity
gluconate acts as molecular inducer
Expression and Regulation
Operons
genes
[gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]-[gene|72404FA6ECD62AEA3EFDB934DFB8DA581875605C|gntK]-[gene|C6810A4ACD51EB8D14E5B30163348058196266A1|gntP]-[gene|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ]
description
[pubmed|10746760,3020045]
regulation
induced by gluconate ([protein|search|GntR]) [Pubmed|3020045]
regulatory mechanism
[protein|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]: repression, [Pubmed|3020045], in [regulon|protein:1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3020045], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]→[gene|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ]

2022-11-15 09:37:21

ghost

19

a4a9f34acee86d883fafe2368089737d1c13df10

02F8B40AEEBB8D4A2614150F30482A3F72134EF4

Biological materials
Mutant
BKE40050 ([gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACACTCACCTTCCTCAC,  downstream forward: _UP4_CTGGCAAAAGGAGCTGAATA
BKK40050 ([gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACACTCACCTTCCTCAC,  downstream forward: _UP4_CTGGCAAAAGGAGCTGAATA
References
8370661,8808939,8288545,7642511,7476858,8596444,3011959,2163901,3037520,2492998,9106211,2419835,2124676,3020045,10746760,8510140,2843515,7476858,3020045,1659648,21106498,22900538,220817675,27829583

1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64

Page visits: 2820

Time of last update: 2022-11-26 17:52:33

Author of last update: Melvin.boenninger