sbp

sbp
168

small basic protein

locus
BSU_15270
Molecular weight
13.17 kDa
pI
10
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
sbp

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3856

This gene is a member of the following regulons

Gene
Coordinates
1,595,935  1,596,300
The protein
Protein family
sbp family (single member, according to UniProt)
Structure
[AF|P28265]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]-[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
description
[Pubmed|18179421]
regulation
expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|1391053]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|15383836], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, (promoter within [protein|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]) [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8106328], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|8320223], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]→[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]

2022-11-27 16:59:02

Jstuelk

36

5a24cdfec598f0a2424898f47e06e5544408d3d6

1A7F525A9A274FAF9AE05A426F5AE7383E95D9E3

genes
[gene|D48B7591467C493D2214D37AEA83643FE8C27BC6|murE]-[gene|4D3D4429E1F387BACB0D5A1084AA8DF179A16685|mraY]-[gene|0A9FF5A66F73464A780914A1424979CE753B3D9C|murD]-[gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]-[gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]-[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
description
[Pubmed|1391053]
regulation
expressed during vegatative growth [Pubmed|1391053]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|15383836], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|8320223], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|D48B7591467C493D2214D37AEA83643FE8C27BC6|murE]→[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]

2022-12-01 19:16:42

Jstuelk

38

68c6899b3f1263bd636c35a4ea9512c00078a714

2F040145AC628A38E3D11955965F4DA256DE6790

genes
[gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]-[gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]-[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
description
[Pubmed|1391053]
regulation
expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|1391053]
Open in new tab

[gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]→[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]

2022-11-29 09:57:16

Jstuelk

36

6fa043950e40c3a1d4f91339581472acb9db18da

C066C3357FB70D8EEB595C678C068B56731F8F59

genes
[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
description
[Pubmed|8106328]
Open in new tab

[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]→[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]

2022-12-01 05:36:13

Jstuelk

35

f37d9a564efeec39a2ef7291ea255a7cf0bf6960

DC16386FDAC4B973DDD9A4C0BCD3FF866F63C22D

genes
[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
description
[Pubmed|18179421]
regulation
expressed during vegatative growth, then switched off, and again expressed during [wiki|sporulation ]in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|1391053]
Open in new tab

[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]→[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]

2022-12-01 20:16:14

Jstuelk

36

3d08ab9489a62734a3c1b81d0d7a7e15bf37e1dc

F5945D130AA23B8820F36AD12C2F42D0A674910E

Biological materials
Mutant
BKE15270 ([gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCACATGACAATTCTCCTCC,  downstream forward: _UP4_TAAAAGAGGATATACATAGG
BKK15270 ([gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCACATGACAATTCTCCTCC,  downstream forward: _UP4_TAAAAGAGGATATACATAGG
References
1391053,8106328,8320223,7590298,18179421

1C6CADD1808CA84CBC19D623DACF4D398EB43174

Page visits: 1536

Time of last update: 2022-12-02 15:53:44

Author of last update: Melvin.boenninger