SubtiWiki SubtiWiki
alaR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

alaR
168

transcriptional regulator ([wiki|Lrp family]) of the [gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]-[gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT] operon

locus
BSU_31410
Molecular weight
18.62 kDa
pI
4.89
Protein length
Gene length
function
unknown
product
transcription regulator ([wiki|Lrp family])
essential
no
synonyms
alaR, yugG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1522

This gene is a member of the following regulons

Gene
Coordinates
3,226,933  3,227,433
The protein
Protein family
([wiki|Lrp family])
[wiki|Domains]
[wiki|HTH asnC-type domain] (aa 3-65) (according to UniProt)
Modification
phosphorylated on Arg-79 [Pubmed|22517742]
Expression and Regulation
Operons
genes
[gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]-[gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]
description
[Pubmed|22383849]
additional information
A [protein|search|ncRNA] is predicted between [gene|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI] and [gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT] [PubMed|20525796]
Open in new tab

[gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]→[gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]

2021-09-18 05:52:50

Jstuelk

6

9d6558c6d1956815b49569180a4013bc92457db5

6BFC2A870201FAF01E264D2DE76E294B4D2167A2

Biological materials
Mutant
MGNA-A622 (yugG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/622 NBRP B. subtilis, Japan]
BKE31410 ([gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGATTCACACCTTTGC,  downstream forward: _UP4_AAAAGAATCGTGGTGTCACC
BKK31410 ([gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGATTCACACCTTTGC,  downstream forward: _UP4_AAAAGAATCGTGGTGTCACC
References
22517742,22383849

1CA87275AFA1B4E4B5E8E10229009F785E70BBA8

Page visits: 1389

Time of last update: 2021-09-23 00:43:11

Author of last update: Melvin.boenninger