mtlR

mtlR
168

transcriptional activator of the [gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]-[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]-[gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD] operon

locus
BSU_04160
Molecular weight
78.67 kDa
pI
5.31
Protein length
Gene length
function
regulation of mannitol utilization
product
transcriptional activator, PRD-type
essential
no
synonyms
mtlR, ydaA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3711

This gene is a member of the following regulons

Gene
Coordinates
467,130  469,214
The protein
Catalyzed reaction/ biological activity
D-mannitol + Nπ-phospho-L-histidyl-[protein] --> D-mannitol 1-phosphate + L-histidyl-[protein] (according to UniProt)
Protein family
[wiki|PRD-containing transcription factors]
[wiki|Domains]
N-terminal DNA-binding domains, two [wiki|PTS]-regulation domains (PRD1 aa 195-300 and PRD2 aa 305-410), EIIB (Gat)-like domain, EIIA (Mtl)-like domain
[wiki|PTS EIIB domain] type-2 (aa 413-502) (according to UniProt)
[wiki|PTS EIIA domain] type-2 (aa 536-683) (according to UniProt)
Structure
[AF|P96574]
Modification
phosphorylated on His-342 and/or His-399 by [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH] [Pubmed|20444094]
phosphorylation on His-599 by [protein|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA] [Pubmed|20444094]
phosphorylation on Cys-419 by [protein|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF] [Pubmed|20444094]
Effectors of protein activity
activity is stimulated by [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-dependent phosphorylation in PRD2 (mechnism of carbon catabolite repression) [Pubmed|20444094]
activity is inhibited by [protein|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]-dependent phosphorylation in the EIIB(Gat)-like domain on Cys-419 (this prevents activity in the absence of mannitol and allows induction in presence of mannitol) [Pubmed|20444094]
[wiki|Localization]
upon interaction with non-phosphorylated [protein|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA], the active [protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR] localizes to the membrane [Pubmed|23279188]
Expression and Regulation
Operons
genes
[gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]
description
[Pubmed|12897001]
regulation
repressed by glucose ([protein|search|CcpA]) [Pubmed|22900538]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|22900538], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22014119], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]

2022-11-29 03:18:21

ghost

19

94cbef71388f5fb1fe4cf9a5408dcb95147eee80

7B36DA36C65291ECB21349F02D2658BA28F7311D

Biological materials
Mutant
BKE04160 ([gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGACCTCCTAGC,  downstream forward: _UP4_TAAACCTGCATGGCACACGT
BKK04160 ([gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGACCTCCTAGC,  downstream forward: _UP4_TAAACCTGCATGGCACACGT
References
Reviews
23318733,9663674
Original Publications
12897001,20444094,10627040,10702268,9988713,23279188,22900538,22014119,26159071

1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2

Page visits: 1924

Time of last update: 2022-12-02 17:57:45

Author of last update: Melvin.boenninger