levR

levR
168

transcriptional activator of the [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]-[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]-[gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]-[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]-[gene|search|sacC ]operon

locus
BSU_27080
Molecular weight
105.99 kDa
pI
5.94
Protein length
Gene length
function
regulation of levan and fructose utilization
product
transcriptional activator, PRD-type (for [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]-dependent promoter)
essential
no
synonyms
levR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3933

This gene is a member of the following regulons

Gene
Coordinates
2,763,025  2,765,832
The protein
Catalyzed reaction/ biological activity
binding to the upstream activating sequence in front of the [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD] gene results in activation of transcription of the [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]-[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]-[gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]-[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]-[gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC] operon, bining occurs in the presence of fructose
Protein family
[wiki|Transcription factors activating transcription at SigL-dependent promoters]
[wiki|PRD-containing transcription factors] (according to UniProt)
[wiki|Domains]
[wiki|Sigma-54 factor interaction domain] (aa 117-348) (according to UniProt)
2 [wiki|PRD domain]s (aa 468-573, aa 831-935) (according to UniProt)
[wiki|PTS EIIA domain] type-4 (aa 574-711) (according to UniProt)
Structure
[AF|P23914]
Modification
phosphorylation (His503, His582, His866) (according to Swiss-Prot)
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|1D2043CC0D8CF64142F0A5993A936C5A196726D4|levR]
description
[pubmed|22383849]
Open in new tab

[gene|1D2043CC0D8CF64142F0A5993A936C5A196726D4|levR]

2022-11-19 13:02:14

Jstuelk

23

193e75b2d341c6b7ce4ce2650fd1858e938928ad

C7710823DC64337F757C1464F6D7EA3565E74BAD

Biological materials
Mutant
BKE27080 ([gene|1D2043CC0D8CF64142F0A5993A936C5A196726D4|levR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE27080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTCTATCATCCTTTGTC,  downstream forward: _UP4_TAAAAACAGTTTTTTCATAT
BKK27080 ([gene|1D2043CC0D8CF64142F0A5993A936C5A196726D4|levR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK27080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTCTATCATCCTTTGTC,  downstream forward: _UP4_TAAAAACAGTTTTTTCATAT
References
1900939,7592487,7592486,8057358,9033408,21906631,9622354

1D2043CC0D8CF64142F0A5993A936C5A196726D4

Page visits: 2665

Time of last update: 2022-11-27 04:08:55

Author of last update: Melvin.boenninger