sspM

sspM
168

small acid-soluble spore protein (minor SASP)

locus
BSU_22290
Molecular weight
3.59 kDa
pI
10.99
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (minor SASP)
essential
no
synonyms
sspM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,339,670  2,339,774
The protein
Structure
[AF|Q7WY65]
Expression and Regulation
Operons
genes
[gene|1D37BB6B73A60C38375FBC8D847E726EE79103B3|sspM]
description
[Pubmed|10806362]
regulation
expressed late during sporulation in the forespore [protein|search|SigG] [Pubmed|10806362]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|10806362], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|1D37BB6B73A60C38375FBC8D847E726EE79103B3|sspM]

2022-12-14 02:48:22

ghost

11

60843bbb8d37aba8f6f547abd88d24a0cfc6dbe5

2457AADC6261BC5491B49C0D5E7026E017C06201

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE22290 ([gene|1D37BB6B73A60C38375FBC8D847E726EE79103B3|sspM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGGCACCTCCTCACAA,  downstream forward: _UP4_TAAGAAGCAAGGAATTTCCT
BKK22290 ([gene|1D37BB6B73A60C38375FBC8D847E726EE79103B3|sspM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGGCACCTCCTCACAA,  downstream forward: _UP4_TAAGAAGCAAGGAATTTCCT
References
10806362,30782632

1D37BB6B73A60C38375FBC8D847E726EE79103B3

Page visits: 928

Time of last update: 2023-02-02 02:00:57

Author of last update: Jstuelk