rbsB

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

rbsB
168

ribose [wiki|ABC transporter] (binding protein)

locus
BSU_35960
Molecular weight
32.07 kDa
pI
6.14
Protein length
Gene length
function
ribose uptake
product
ribose [wiki|ABC transporter] (binding protein)
essential
no
synonyms
rbsB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1879

This gene is a member of the following regulons

Gene
Coordinates
3,706,145  3,707,062
The protein
Protein family
bacterial solute-binding protein 2 family (single member, according to UniProt)
Structure
[PDB|2GX6] (from ''Escherichia coli k12 mutant'', 54% identity, 71% similarity)
[AF|P36949]
[wiki|Localization]
extracellular (signal peptide), lipid modification as retention signal [Pubmed|18957862]
attached to the cell membrane (via [protein|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[protein|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]-[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]-[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]-[gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]-[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]
description
[Pubmed|7921236]
regulation
expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|7921236], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|7592460], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7511775], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]→[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]

2022-04-28 00:34:36

ghost

15

ecd23e67fb36c12e46381b0bbd805e52a3ac9a7b

9A76230F5BF071D52DFA7084300C0507E658DAA8

Biological materials
Mutant
BKE35960 ([gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACCCTCCTAAGC,  downstream forward: _UP4_TAATTGTCTGATGTTTAGGA
BKK35960 ([gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACCCTCCTAAGC,  downstream forward: _UP4_TAATTGTCTGATGTTTAGGA
References
10092453,16872404,7511775,7592460,18957862,7921236

1D67888E79B09956F9258F4068546D8C67103549

Page visits: 2024

Time of last update: 2022-05-19 08:14:36

Author of last update: Melvin.boenninger