yraE

yraE
168

forespore-specific sporulation protein, similar to spore coat protein

locus
BSU_26980
Molecular weight
7.34 kDa
pI
5.07
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yraE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5896

This gene is a member of the following regulons

Gene
Coordinates
2,754,607  2,754,804
The protein
Structure
[AF|O06011]
Expression and Regulation
Operons
genes
[gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]-[gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]-[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]-[gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]-[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]→[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]

2023-02-05 08:41:10

ghost

47

d7b65b29af87b17d60d957745dbcb60005e27aaf

1230FD48E94D5C4C5D5DC8D83656D0C540213821

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE26980 ([gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCCATTTCTGTAACCTCCG,  downstream forward: _UP4_CAAGAATGAGGAGATGAATA
BKK26980 ([gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCCATTTCTGTAACCTCCG,  downstream forward: _UP4_CAAGAATGAGGAGATGAATA
References
16497325,30782632

1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0

Page visits: 993

Time of last update: 2023-02-02 21:43:55

Author of last update: Jstuelk