iolJ

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

iolJ
168

2-deoxy-5-keto-gluconic acid-6-phosphate aldolase, formation of dihydroxyacetone phosphate and malonic semialdehyde (6th reaction)

locus
BSU_39670
Molecular weight
31.22 kDa
pI
4.85
Protein length
Gene length
function
myo-inositol catabolism
product
2-deoxy-5-keto-gluconic acid-6-phosphate aldolase, formation of dihydroxyacetone phosphate and malonic semialdehyde (6th reaction)
essential
no
ec
4.1.2.29
synonyms
iolJ, fbaB, yxdI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0191

This gene is a member of the following regulons

Gene
Coordinates
4,073,081  4,073,953
The protein
Catalyzed reaction/ biological activity
6-phospho-5-dehydro-2-deoxy-D-gluconate --> 3-oxopropanoate + dihydroxyacetone phosphate (according to UniProt)
Protein family
class II fructose-bisphosphate aldolase family (with [protein|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA], according to UniProt)
Structure
[PDB|4TO8] (from Staphylococcus aureus, 56% identity) [pubmed|25390935]
[AF|P42420]
Effectors of protein activity
inhibited by alpha-keto acids [Pubmed|24624]
Paralogous protein(s)
[protein|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]
Expression and Regulation
Operons
genes
[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
description
[Pubmed|9226270]
regulation
induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
regulatory mechanism
[protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]: repression, [Pubmed|9887260,9226270], in [regulon|protein:5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9226270], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]→[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]

2022-04-28 01:52:36

ghost

20

4fd092965338ef1511600132442d2247a2693c98

C19E63046F0B412961D2626F72E0308D922D50B2

Biological materials
Mutant
MGNA-B701 (iolJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1700 NBRP B. subtilis, Japan]
BKE39670 ([gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCACCCCTCCTTTAT,  downstream forward: _UP4_TAAAGAGACCAGAAACCGCC
BKK39670 ([gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCACCCCTCCTTTAT,  downstream forward: _UP4_TAAAGAGACCAGAAACCGCC
labs
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
[[Ken-ichi Yoshida]], Kobe University, Japan
References
9226270,18310071,9887260,18310071,25390935

1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5

Page visits: 2104

Time of last update: 2022-05-19 08:16:34

Author of last update: Melvin.boenninger